ORFeome > MGC75573 – XORFeome 2.0

MGC75573 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75573, mRNA (cDNA clone MGC:75573 IMAGE:5379101), complete cds
Gene Symbol: MGC75573
Gene ID: 394830
ORF gb_acc:
ORF ID: 10075

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063189

Library Location

Plate ID: GDExt11002
Well Location: D03

EST Sequences

Clone: MGC:75573 IMAGE:5379101
Trimmed Sequence: ATGACAACAGAGGGAATTGTGCTTTTACTAGTGCTGCCACTCTGCTTGGCGCTTGCACTACCGTGCCATGCCCAGCTGCAAGATGATGCATCAGGCCAAGATGTATGTAAGAAATGCCATACAAATGCCACCTGCCTTGAGAGAAACAAAAAGTATTCCTGTATCTGTAACTATGGATTAATTGGGAATGGAAGGACACATTGTCTGGATAAGGATGAGTGCCAGATTGGTTCTTACAAGATCTGTGGGAATCACACAGCATGTCACAATACACATGGCAGCTTCTTCTGTGTCTGCCTGGATGGATATCGGCCTTCCAACAACCACAAGCACTTTATACCTAATGATGGCACGTTCTGCACTGATATTGATGAATGTGAGTCAGCGGATATCTGTGGCTATAAGGGAAAATGCAAAAATATCCCAGGGAGTTATGAGTGCTATTGCATGGATGGCTATCAACTGAAAAATGGAACAGAACCATTCCAGGCCAACAGTGATAATGGATGCGTAGATGTTGATGAATGTGAAGCAGAAGACATTTGTGGACATAATGCGAAATGTAGAAATGTCCCAGGAAACCATGAGTGTTACTGCATGGAGGGATATAGGCTAAACAATGGCACAGAACCTTTTCAAGCACATAGTCGCATGAATTTATGCTCAGTTATTGATTGCGGACAACCACCTGCGCTTTTACATTCTCAAATGAATCTAGAAGGCAATACTACGTTTGGAAGTCAAGTGACATACAGGTGTGATGCAGGATTCACTGCTACTGCGGGACGCGCCATGTCCATCTGCACTTCTAATGGGACATGGGAAGGAGCCAGTCTTGTTTGCACAGTTATAGACTGTGGTTTTCCACCAGTCGTACCCAATGCACTAATAAACTCCTCAGACAACACCACGTTTGGAAGCAATGTGACATACACATGTATGAAAGGATATGTGGCATCCAGTGGTTATGGTTTTGCAAGATGTGCACAAAATGGAAAGTGGGAAGCAGCTACTTTGTCATGCCAAGTGGTGGATTGTGGCCAACCTCCATCCATTCAGCATACATCCTCAAAATTTGCAAGAAACACCACTTTGGGAAACACTATAGCATATGAATGCATGTCTGGCTATGTCAAGCAGAGTGGGAATGGAATTGCTGTGTGTAATGAAGATGGAGAATGGGATGGAGCTGACCTTATATGTAAAGAAATAAACTGTGGGCTGCCACCTCCAGTTCCCAATACACAGGTGATTTTGAGCGGAACAACAAACCTTGGAAGTGAAGTGGAATACAAATGTGTGCATGGTTACTACAACCCTGGCAACAGAAGTGTGTCAAGATGCACCCTAAATGAAAAATGGGAAGAAGTAAATGTCACATGTAAAGTGATTGGAATTTTAATTGGGAACGTGACTGTTTTCAATGAGACGTGTCTACGGTGGAGAAAAAGTTCTGAAATAATAGACTGGGAGATCCTATATAAGTTTAGCATTCTTGGAAAAGGATGGCACCAGATACATTATGTTCATGAAAAAGATTTCAAGCTCCTCACAAACAACAGTTTTCAGTGTTTGGATCTTCTTCCTGGAAATAACTACTTGGTGATAATGAGAGCTGTGTTCCCCGAGATGCAGGAAATATCAATAAATATAACGTTGGAAACAGCTATGATAAAGAGATTTGGTGACATTACACTGTTCAATACAACATGTCTGCAGTGGACAAAGAGTTCTGGAAAAAATGAAGAACTAGAGGAATACACAGTCTTGATAAAAGGACAAGTTTGGAAACCCCCAAAAATATCGCTGAACATAATGTTTAATTTCAGTACAAGCAGTAGGAATCCGGTGCTATGTTTAATGCTGCCCCCAGAGGAAGAATATATTGTTAATGTTACTGAATCATCCACAGGACTGTCTTCATCTATTCCTTTCCGCACCTTGGGGCATGACAGTGAAGATGTCAGTGGCACAGCACCTTTGGGTGAAAATTGTTTGCAATGGAACAGAAGTATAGAGGAGAATGGGGTGCAAGAGATTTATAGAATTCATGTGCAAGAGGCACAGGGGCAACCCAAGCCAAATCCCCAGCTCTTGCTGTTTAACATCAGTACAGACCAAGGTACATCTCAGGTGTGCTTCAAGATAGCAACAGATCAGCAACAATTAAATATGACAGAAGCCCCATCTCCTCCTGAAGCCAACACAACTAGAGAACTTGACACTCCACTTCCAAAGGTGCAGTTTGTCTCAAAATATGGTCAGCTGCCAAAAGTAAGCATACAGAAAACTGACCAACATGCACCCTTCAGTTCCTACCAGGTATTTGTGAAACATTCTGGCCCCCTGTGTTCCTTTACTTGTGATTCTCTGGAAGCGGTGCCGTACTTTCACAATATTTCCAAGACTCGTGCATACGTCACAGCAGAATTTTCACCTAGTGATATACCTGAGGTTCTAGAGTTCTCACTAGGGGACAGGCAATACTACGGAGAGTTCTACAATGCCCCTTTAGCACAAGAAAAAGATTACTGCATCATCCTGAGAATCATCAGTAGGTGGGATCGGGTACCAGAGTGTATCCTTGTAGCAGAAATTAAAGGTTTTACACCTTCAAGGAATTATATGAATATAGTTTTACCAGGATCAGTTGCCTTTGTGTGGTTTATAATATTTCTTTCTTACTCAGCAGCACGGTGCTGTAAGAGGAGGTGA
Full Trace Sequence: atttgccttaaacatgctagtggggtacattcagctgtatctaatgtattggaatggtgactcagtccagctctggacaagttgtgcttctgtattgtgctttgtgtgtgtgacctggcacaggaaaaagacatcctgcagctgataaaaagggtctctcggctttggatttctgttacaagtgcaaaggcgaagaaccgaatacagggaggagcagtgacagagcaaagttagtgccatgacaacagagggaattgtgcttttactagtgctgccactctgcttggcgcttgcactaccgtgccatgcccagctgcaagatgatgcatcaggccaagatgtatgtaagaaatgccatacaaatgccacctgccttgagagaaacaaaaagtattcctgtatctgtaactatggattaattgggaatggaaggacacattgtctggataaggatgagtgccagattggttcttacaagatctgtgggaatcacacagcatgtcacaatacacatggcagcttcttctgtgtctgcctggatggatatcggccttccaacaaccacaagcactttatacctaatgatggcacgttctgcactgatattgatgaatgtgagtcagcggatatctgtggctataagggaaaatgcaaaaatatcccagggagttatgagtgctattgcatggatggctatcaactgaaaaatggaacagaaccattccaggccaacagtgataatggatgcgtagatgttgatgaatgtgaagcagaagacatttgtggacataatgcgaaatgtagaaatgtcccaggaaaccatgagtgttactgcatggagggatataggctaaacaatggcacagaaccttttcaagcacatagtcgcatgaatttatgctcagttattgattgcggacaaccacctgcgcttttacattctcaaatgaatctagaaggcaatactacgtttggaagtcaagtgacatacaggtgtgatgcaggattcactgctactgcgggacgcgccatgtccatctgcacttctaatgggacatgggaaggagccagtcttgtttgcacagttatagactgtggttttccaccagtcgtacccaatgcactaataaactcctcagacaacaccacgtttggaagcaatgtgacatacacatgtatgaaaggatatgtggcatccagtggttatggttttgcaagatgtgcacaaaatggaaagtgggaagcagctactttgtcatgccaagtggtggattgtggccaacctccatccattcagcatacatcctcaaaatttgcaagaaacaccactttgggaaacactatagcatatgaatgcatgtctggctatgtcaagcagagtgggaatggaattgctgtgtgtaatgaagatggagaatgggatggagctgaccttatatgtaaagaaataaactgtgggctgccacctccagttcccaatacacaggtgattttgagcggaacaacaaaccttggaagtgaagtggaatacaaatgtgtgcatggttactacaaccctggcaacagaagtgtgtcaagatgcaccctaaatgaaaaatgggaagaagtaaatgtcacatgtaaagtgattggaattttaattgggaacgtgactgttttcaatgagacgtgtctacggtggagaaaaagttctgaaataatagactgggagatcctatataagtttagcattcttggaaaaggatggcaccagatacattatgttcatgaaaaagatttcaagctcctcacaaacaacagttttcagtgtttggatcttcttcctggaaataactacttggtgataatgagagctgtgttccccgagatgcaggaaatatcaataaatataacgttggaaacagctatgataaagagatttggtgacattacactgttcaatacaacatgtctgcagtggacaaagagttctggaaaaaatgaagaactagaggaatacacagtcttgataaaaggacaagtttggaaacccccaaaaatatcgctgaacataatgtttaatttcagtacaagcagtaggaatccggtgctatgtttaatgctgcccccagaggaagaatatattgttaatgttactgaatcatccacaggactgtcttcatctattcctttccgcaccttggggcatgacagtgaagatgtcagtggcacagcacctttgggtgaaaattgtttgcaatggaacagaagtatagaggagaatggggtgcaagagatttatagaattcatgtgcaagaggcacaggggcaacccaagccaaatccccagctcttgctgtttaacatcagtacagaccaaggtacatctcaggtgtgcttcaagatagcaacagatcagcaacaattaaatatgacagaagccccatctcctcctgaagccaacacaactagagaacttgacactccacttccaaaggtgcagtttgtctcaaaatatggtcagctgccaaaagtaagcatacagaaaactgaccaacatgcacccttcagttcctaccaggtatttgtgaaacattctggccccctgtgttcctttacttgtgattctctggaagcggtgccgtactttcacaatatttccaagactcgtgcatacgtcacagcagaattttcacctagtgatatacctgaggttctagagttctcactaggggacaggcaatactacggagagttctacaatgcccctttagcacaagaaaaagattactgcatcatcctgagaatcatcagtaggtgggatcgggtaccagagtgtatccttgtagcagaaattaaaggttttacaccttcaaggaattatatgaatatagttttaccaggatcagttgcctttgtgtggtttataatatttctttcttactcagcagcacggtgctgtaagaggaggtgagagggaatcattcatatatggacactgtaagactctgcctttgttgttgcatttctcagaaatgttgggatgactgatagaaaacacacatttttcaaaataatggaacatagacttgaataaatctgcttgaaagccactgtggtcttttcatgatcatgagggcatcagtggaccttgcttctgcaagaatgttattgtctcctttgttttgactacaagaatcatcaacagcaaagagttagtagaagttgttgaatgaaacaaaatccaccgaggacctcaataattgtctgctagacatgatgttgcactatctgattactgataaagcttttttcaagctgacaatgggacacttgcaaagtaaaggactgtttcaagagacatttcatgtgatgtatgaatcatgagttttttggtctatatttatttcttatttctatccaacctgcatttgtcattgtaatttcctcccacttttcccctttctgattgtagaaataaacatttattttgaaaaggaaaaaaaaaaaaaaaaaaaa
Translation: MTTEGIVLLLVLPLCLALALPCHAQLQDDASGQDVCKKCHTNATCLERNKKYSCICNYGLIGNGRTHCLDKDECQIGSYKICGNHTACHNTHGSFFCVCLDGYRPSNNHKHFIPNDGTFCTDIDECESADICGYKGKCKNIPGSYECYCMDGYQLKNGTEPFQANSDNGCVDVDECEAEDICGHNAKCRNVPGNHECYCMEGYRLNNGTEPFQAHSRMNLCSVIDCGQPPALLHSQMNLEGNTTFGSQVTYRCDAGFTATAGRAMSICTSNGTWEGASLVCTVIDCGFPPVVPNALINSSDNTTFGSNVTYTCMKGYVASSGYGFARCAQNGKWEAATLSCQVVDCGQPPSIQHTSSKFARNTTLGNTIAYECMSGYVKQSGNGIAVCNEDGEWDGADLICKEINCGLPPPVPNTQVILSGTTNLGSEVEYKCVHGYYNPGNRSVSRCTLNEKWEEVNVTCKVIGILIGNVTVFNETCLRWRKSSEIIDWEILYKFSILGKGWHQIHYVHEKDFKLLTNNSFQCLDLLPGNNYLVIMRAVFPEMQEISINITLETAMIKRFGDITLFNTTCLQWTKSSGKNEELEEYTVLIKGQVWKPPKISLNIMFNFSTSSRNPVLCLMLPPEEEYIVNVTESSTGLSSSIPFRTLGHDSEDVSGTAPLGENCLQWNRSIEENGVQEIYRIHVQEAQGQPKPNPQLLLFNISTDQGTSQVCFKIATDQQQLNMTEAPSPPEANTTRELDTPLPKVQFVSKYGQLPKVSIQKTDQHAPFSSYQVFVKHSGPLCSFTCDSLEAVPYFHNISKTRAYVTAEFSPSDIPEVLEFSLGDRQYYGEFYNAPLAQEKDYCIILRIISRWDRVPECILVAEIKGFTPSRNYMNIVLPGSVAFVWFIIFLSYSAARCCKRR
Donor tissue: tailbud