ORFeome > MGC75582 – XORFeome 2.0

MGC75582 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75582, mRNA (cDNA clone MGC:75582 IMAGE:5379166), complete cds
Gene Symbol: MGC75582
Gene ID: 394982
ORF gb_acc: MG132776
ORF ID: 10091

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064152

Library Location

Plate ID: GDExt11002
Well Location: H05

EST Sequences

Clone: MGC:75582 IMAGE:5379166
Trimmed Sequence: ATGTGTGACGATGAGGAGACCACCGCTCTTGTCTGTGACAATGGCTCTGGGCTGGTGAAAGCTGGCTTTGCAGGAGATGATGCTCCCAGGGCAGTGTTCCCATCTATTGTGGGTCGCCCACGTCACCAGGGAGTCATGGTAGGCATGGGACAGAAGGACTCCTATGTTGGGGATGAAGCCCAAAGCAAGAGGGGTATCCTCACCCTGAAGTATCCCATTGAGCATGGCATAATCACTAACTGGGACGACATGGAAAAGATCTGGCATCACACCTTCTACAATGAACTTCGTGTTGCCCCTGAAGAGCACCCTACACTGCTAACAGAAGCTCCACTTAACCCAAAAGCCAACAGAGAAAAGATGACACAGATCATGTTTGAAACCTTCAATGTGCCAGCCATGTATGTTGCAATCCAAGCCGTGCTGTCTCTCTATGCCTCTGGTCGTACCACTGGTATTGTGCTGGACTCTGGAGATGGTGTCACCCACAATGTCCCCATATATGAAGGTTATGCTTTGCCTCATGCCATCATGCGTCTGGACCTGGCAGGTCGCGACCTGACTGACTACCTCATGAAGATCCTAACTGAACGTGGGTACTCATTTGTTACAACAGCAGAAAGGGAAATTGTGCGTGACATCAAGGAAAAGTTGTGCTATGTTGCCCTGGACTTTGAAAATGAAATGGCAACAGCTGCATCATCCTCTTCCCTGGAAAAGAGTTATGAATTACCAGATGGTCAAGTTATCACCATTGGTAATGAGCGTTTCCGCTGCCCCGAGACCCTGTTCCAGCCTTCTTTCATCGGCATGGAATCTGCTGGCATTCATGAGACCACCTACAACAGCATCATGAAATGTGACATTGACATCCGCAAGGACTTGTATGCCAACAATGTTCTCTCTGGTGGTACCACAATGTACCCAGGTATTGCCGACCGTATGCAGAAGGAAATCACTGCTCTGGCTCCAAGCACCATGAAAATCAAGATCATTGCACCACCCGAACGCAAGTACTCTGTCTGGATTGGAGGCTCTATTCTTGCATCTCTCTCAACCTTCCAGCAAATGTGGATCACCAAGCAAGAATACGATGAAGCTGGACCTTCCATTGTCCACCGTAAATGCTTCTAA
Full Trace Sequence: ccttccgctcggtcagtcaaacttttcaagacaagcaaccatgtgtgacgatgaggagaccaccgctcttgtctgtgacaatggctctgggctggtgaaagctggctttgcaggagatgatgctcccagggcagtgttcccatctattgtgggtcgcccacgtcaccagggagtcatggtaggcatgggacagaaggactcctatgttggggatgaagcccaaagcaagaggggtatcctcaccctgaagtatcccattgagcatggcataatcactaactgggacgacatggaaaagatctggcatcacaccttctacaatgaacttcgtgttgcccctgaagagcaccctacactgctaacagaagctccacttaacccaaaagccaacagagaaaagatgacacagatcatgtttgaaaccttcaatgtgccagccatgtatgttgcaatccaagccgtgctgtctctctatgcctctggtcgtaccactggtattgtgctggactctggagatggtgtcacccacaatgtccccatatatgaaggttatgctttgcctcatgccatcatgcgtctggacctggcaggtcgcgacctgactgactacctcatgaagatcctaactgaacgtgggtactcatttgttacaacagcagaaagggaaattgtgcgtgacatcaaggaaaagttgtgctatgttgccctggactttgaaaatgaaatggcaacagctgcatcatcctcttccctggaaaagagttatgaattaccagatggtcaagttatcaccattggtaatgagcgtttccgctgccccgagaccctgttccagccttctttcatcggcatggaatctgctggcattcatgagaccacctacaacagcatcatgaaatgtgacattgacatccgcaaggacttgtatgccaacaatgttctctctggtggtaccacaatgtacccaggtattgccgaccgtatgcagaaggaaatcactgctctggctccaagcaccatgaaaatcaagatcattgcaccacccgaacgcaagtactctgtctggattggaggctctattcttgcatctctctcaaccttccagcaaatgtggatcaccaagcaagaatacgatgaagctggaccttccattgtccaccgtaaatgcttctaagcttgtgactgtatggtgcaagtttttctatcagtgcagcaatcacagtataaaacaaaaataatgtttaccataaggtacaatgaagacctacagagactaatatgtaagtgacatcatggagatatagtttacctccctaattacattttagcaatcaattcttcgctttttcaagcattaatttaaaacaaactcttctgttttacaatctaatttaaaagagaagagggtagatatatatcaatgttgagatgcctgccgtaaccctccaacagtgcatgttttcagtagctttgttactttataacaactactcgagtggaaagcttattgaatacctgtagtataagggggggggggggagttggtgcaacctgcattgtctttatctaattgctttttaataaaatatggctcattccaaaatctttgcaaatacctaaatccatgatgtaattggcacaaactgctgctatgttatatgtatcattattcacatgtacatttattgtgtttttttttacatcttgataggtaataacaatatgtgacatgtagatttagttttctatggtcattcagcactgaaattctgtttactgtgaagggagaacataataaaatgttttgcaatcctcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MCDDEETTALVCDNGSGLVKAGFAGDDAPRAVFPSIVGRPRHQGVMVGMGQKDSYVGDEAQSKRGILTLKYPIEHGIITNWDDMEKIWHHTFYNELRVAPEEHPTLLTEAPLNPKANREKMTQIMFETFNVPAMYVAIQAVLSLYASGRTTGIVLDSGDGVTHNVPIYEGYALPHAIMRLDLAGRDLTDYLMKILTERGYSFVTTAEREIVRDIKEKLCYVALDFENEMATAASSSSLEKSYELPDGQVITIGNERFRCPETLFQPSFIGMESAGIHETTYNSIMKCDIDIRKDLYANNVLSGGTTMYPGIADRMQKEITALAPSTMKIKIIAPPERKYSVWIGGSILASLSTFQQMWITKQEYDEAGPSIVHRKCF
Donor tissue: tailbud