ORFeome > MGC75584 – XORFeome 2.0

MGC75584 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75584, mRNA (cDNA clone MGC:75584 IMAGE:5379175), complete cds
Gene Symbol: MGC75584
Gene ID: 394988
ORF gb_acc: MG132800
ORF ID: 10135

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064153

Library Location

Plate ID: GDExt11002
Well Location: H03

EST Sequences

Clone: MGC:75584 IMAGE:5379175
Trimmed Sequence: ATGGCTCCGCCGGGAGAATACAAGGTGGCGGGGGACGGGATGGAGCAGATGGAGATGGACGAGTCCCGTGGAGGTATTGGCCTGAGGCAGTATTACTTGTCCAAGATTGAAGATCTACAGCTTGTTGTTAATGACAAGAGTCAGAATCTCAGGCGCCTGCAAGCACAGAGGAATGAACTGAACGCTAAAGTGAGGCTACTGAGGGAGGAGCTGCAGCTGCTTCAAGAGCAGGGATCCTACGTAGGAGAAGTGGTCAGAGCTATGGACAAGAAGAAAGTATTGGTTAAGGTTCACCCCGAGGGGAAATTTGTTGTGGATATTGATAAAAATATTGATATCAATGATGTCACACCAAACTGTCGAGTCGCTCTGCGCAATGACAGTTACACACTGCATAAGATCCTGCCCAATAAGGTTGATCCCTTAGTGTCCTTGATGATGGTGGAGAAAGTACCAGACTCCACCTATGAGATGATTGGTGGCTTGGATAAACAGATCAAGGAAATCAAGGAGGTCATTGAACTGCCTGTGAAACATCCGGAGCTCTTTGAAGCCTTGGGTATAGCGCAGCCCAAGGGTGTGTTGCTGTACGGACCTCCTGGTACTGGAAAGACTCTTTTGGCTCGTGCTGTTGCCCATCACACAGACTGCACATTTATACGAGTCTCTGGATCTGAACTGGTGCAGAAGTTCATCGGAGAAGGTGCTCGTATGGTGCGTGAGTTGTTCGTTATGGCCCGAGAACACGCTCCCTCCATTATCTTTATGGATGAAATTGATTCGATTGGGTCCTCTCGGCTCGAGGGGGGCTCAGGAGGAGACAGTGAGGTTCAGCGCACTATGCTTGAGCTGCTTAACCAACTGGATGGATTTGAGGCAACAAAGAACATAAAGGTAATCATGGCAACTAACAGAATCGATATATTGGACTCTGCTCTGCTGCGCCCAGGTCGCATTGACAGGAAGATAGAATTCCCACCTCCTAATGAAGAGGCCCGTCTGGACATCCTGAAAATTCACTCAAGAAAAATGAACTTGACTCGTGGGATCAACCTGCGTAAAATAGCAGAACTGATGCCTGGGGCATCAGGGGCTGAAGTGAAGGGGGTGTGCACAGAGGCGGGGATGTATGCTCTTCGCGAGAGGAGGGTGCACGTCACACAAGAAGACTTTGAAATGGCTGTAGCAAAGGTGATGCAGAAAGACAGCGAGAAGAACATGTCCATTAAGAAGCTGTGGAAGTGA
Full Trace Sequence: gtcgcttccggtcctgagtcacggtaaagcgaagaatggctccgccgggagaatacaaggtggcgggggacgggatggagcagatggagatggacgagtcccgtggaggtattggcctgaggcagtattacttgtccaagattgaagatctacagcttgttgttaatgacaagagtcagaatctcaggcgcctgcaagcacagaggaatgaactgaacgctaaagtgaggctactgagggaggagctgcagctgcttcaagagcagggatcctacgtaggagaagtggtcagagctatggacaagaagaaagtattggttaaggttcaccccgaggggaaatttgttgtggatattgataaaaatattgatatcaatgatgtcacaccaaactgtcgagtcgctctgcgcaatgacagttacacactgcataagatcctgcccaataaggttgatcccttagtgtccttgatgatggtggagaaagtaccagactccacctatgagatgattggtggcttggataaacagatcaaggaaatcaaggaggtcattgaactgcctgtgaaacatccggagctctttgaagccttgggtatagcgcagcccaagggtgtgttgctgtacggacctcctggtactggaaagactcttttggctcgtgctgttgcccatcacacagactgcacatttatacgagtctctggatctgaactggtgcagaagttcatcggagaaggtgctcgtatggtgcgtgagttgttcgttatggcccgagaacacgctccctccattatctttatggatgaaattgattcgattgggtcctctcggctcgaggggggctcaggaggagacagtgaggttcagcgcactatgcttgagctgcttaaccaactggatggatttgaggcaacaaagaacataaaggtaatcatggcaactaacagaatcgatatattggactctgctctgctgcgcccaggtcgcattgacaggaagatagaattcccacctcctaatgaagaggcccgtctggacatcctgaaaattcactcaagaaaaatgaacttgactcgtgggatcaacctgcgtaaaatagcagaactgatgcctggggcatcaggggctgaagtgaagggggtgtgcacagaggcggggatgtatgctcttcgcgagaggagggtgcacgtcacacaagaagactttgaaatggctgtagcaaaggtgatgcagaaagacagcgagaagaacatgtccattaagaagctgtggaagtgattttttttttcggttcccattacactctgctcccagctgaagccctgcaatgtcagcctgttttgattattaaacccagcgttcccaacaaggctcgcagtaaattatcagaaaactcaacacaaactcctgtaatctaaagatctttaacacctggctttccagttttttttttgctaacagggaatgctgggagccacaatatggaagcaccctgaagcctattattctaggagaccacgctttctctataaattagactattccattgggcatttagtacggcgggattttggttttgtaacggatatgtgtatgttatctcatgtgaaataaatacaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAPPGEYKVAGDGMEQMEMDESRGGIGLRQYYLSKIEDLQLVVNDKSQNLRRLQAQRNELNAKVRLLREELQLLQEQGSYVGEVVRAMDKKKVLVKVHPEGKFVVDIDKNIDINDVTPNCRVALRNDSYTLHKILPNKVDPLVSLMMVEKVPDSTYEMIGGLDKQIKEIKEVIELPVKHPELFEALGIAQPKGVLLYGPPGTGKTLLARAVAHHTDCTFIRVSGSELVQKFIGEGARMVRELFVMAREHAPSIIFMDEIDSIGSSRLEGGSGGDSEVQRTMLELLNQLDGFEATKNIKVIMATNRIDILDSALLRPGRIDRKIEFPPPNEEARLDILKIHSRKMNLTRGINLRKIAELMPGASGAEVKGVCTEAGMYALRERRVHVTQEDFEMAVAKVMQKDSEKNMSIKKLWK
Donor tissue: tailbud