ORFeome > MGC75636 – XORFeome 2.0

MGC75636 – XORFeome 2.0

General Information

Species: Xenopus tropicalis casein kinase 1, delta, mRNA (cDNA clone MGC:75636 IMAGE:5379499), complete cds
Gene Symbol: MGC75636
Gene ID: 394689
ORF gb_acc: MG132868
ORF ID: 10226

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC062487

Library Location

Plate ID: GDExt11002
Well Location: F08

EST Sequences

Clone: MGC:75636 IMAGE:5379499
Trimmed Sequence: ATGGAGTTGAGAGTCGGAAACAGGTATCGGTTGGGTCGAAAGATCGGCAGCGGCTCGTTCGGTGACATATATTTGGGCACTGATATTGCAGCGGCAGAAGAAGTTGCTATCAAACTAGAATGTGTGAAAACCAAACATCCTCAGCTTCATATTGAGAGCAAGATCTATAAAATGATGCAAGGAGGGGTGGGGATTCCAACAATAAAATGGTGTGGCGCAGAAGGAGATTACAACGTCATGGTCATGGAATTACTAGGACCAAGTCTTGAAGACCTCTTTAATTTCTGCTCCAGGAAATTTAGTTTAAAAACTGTTCTTCTTCTTGCTGACCAGATGATCAGCCGAATTGAATACATTCATTCCAAAAACTTTATCCATCGGGATGTGAAGCCTGACAACTTTCTGATGGGGCTTGGAAAGAAAGGCAACCTAGTGTATATCATTGATTTTGGGCTGGCCAAAAAATACAGAGATGCTCGCACACACCAGCATATACCATATCGTGAAAACAAGAACTTAACTGGAACAGCTCGCTATGCATCTATTAACACCCACCTTGGAATAGAACAATCACGGAGAGATGATTTAGAGTCTCTTGGATATGTTCTTATGTACTTTAACCTTGGTTCCCTCCCATGGCAAGGGTTAAAAGCTGCCACCAAAAGGCAAAAGTATGAACGTATCAGTGAAAAGAAGATGTCCACACCAATAGAAGTTCTCTGTAAAGGCTATCCATCTGAGTTTGCTACATACCTGAATTTCTGTCGGTCCTTACGTTTTGATGATAAGCCAGACTATTCTTACTTACGACAACTCTTCAGAAATCTCTTTCACAGACAGGGCTTCTCTTATGACTACGTGTTTGACTGGAACATGCTAAAATTCGGTGCAAATCGTGCAGCTGAAGATGCTGAACGTGAAAGGAGAGAAAGAGAAGAGAGACTTCGGCACCCACGGAACCCTGCTGCAAGAGGCTTACCCTCAACTGCTTCCGGCAGACTGCGAGGCACTCAGGAAGTAACGCCATCCACTCCACTTACCCCAACTTCACACACTGCAAACACCTCTCCTCGACCCGTATCTGGAATGGAACGTGAGAGAAAAGTCAGTATGAGATTGCATCGGGGTGCTCCAGTTAATGTCTCTTCCTCTGATTTAACTGGCAGGCAAGAAACCTCACGCATGTCAACTTCTCAGATACCAAGTCGAGTGGCTTCCAGTGGTCTTCCATCAACAGTACACCGATGA
Full Trace Sequence: atcggcctaagtactcggtataatccgcctaaatcctacgttttaaggcttcccgggagcgcggaagtgaaaggaacacagagagcgctctttgatctatcgtaccggcactattttatgctccctagtagtggatggaaaacgtaaattgatggtgaaaagtgccccgggctttagagactgatagctggggaaggaggaaagggcctgcacggcaggatggagttgagagtcggaaacaggtatcggttgggtcgaaagatcggcagcggctcgttcggtgacatatatttgggcactgatattgcagcggcagaagaagttgctatcaaactagaatgtgtgaaaaccaaacatcctcagcttcatattgagagcaagatctataaaatgatgcaaggaggggtggggattccaacaataaaatggtgtggcgcagaaggagattacaacgtcatggtcatggaattactaggaccaagtcttgaagacctctttaatttctgctccaggaaatttagtttaaaaactgttcttcttcttgctgaccagatgatcagccgaattgaatacattcattccaaaaactttatccatcgggatgtgaagcctgacaactttctgatggggcttggaaagaaaggcaacctagtgtatatcattgattttgggctggccaaaaaatacagagatgctcgcacacaccagcatataccatatcgtgaaaacaagaacttaactggaacagctcgctatgcatctattaacacccaccttggaatagaacaatcacggagagatgatttagagtctcttggatatgttcttatgtactttaaccttggttccctcccatggcaagggttaaaagctgccaccaaaaggcaaaagtatgaacgtatcagtgaaaagaagatgtccacaccaatagaagttctctgtaaaggctatccatctgagtttgctacatacctgaatttctgtcggtccttacgttttgatgataagccagactattcttacttacgacaactcttcagaaatctctttcacagacagggcttctcttatgactacgtgtttgactggaacatgctaaaattcggtgcaaatcgtgcagctgaagatgctgaacgtgaaaggagagaaagagaagagagacttcggcacccacggaaccctgctgcaagaggcttaccctcaactgcttccggcagactgcgaggcactcaggaagtaacgccatccactccacttaccccaacttcacacactgcaaacacctctcctcgacccgtatctggaatggaacgtgagagaaaagtcagtatgagattgcatcggggtgctccagttaatgtctcttcctctgatttaactggcaggcaagaaacctcacgcatgtcaacttctcagataccaagtcgagtggcttccagtggtcttccatcaacagtacaccgatgaacacattcctcacactgggcggatattgcatggctgatctttcattggcttcacaagcaaacagtataaaaaatactcaaaaaaaaaaaaaaaa
Translation: MELRVGNRYRLGRKIGSGSFGDIYLGTDIAAAEEVAIKLECVKTKHPQLHIESKIYKMMQGGVGIPTIKWCGAEGDYNVMVMELLGPSLEDLFNFCSRKFSLKTVLLLADQMISRIEYIHSKNFIHRDVKPDNFLMGLGKKGNLVYIIDFGLAKKYRDARTHQHIPYRENKNLTGTARYASINTHLGIEQSRRDDLESLGYVLMYFNLGSLPWQGLKAATKRQKYERISEKKMSTPIEVLCKGYPSEFATYLNFCRSLRFDDKPDYSYLRQLFRNLFHRQGFSYDYVFDWNMLKFGANRAAEDAERERREREERLRHPRNPAARGLPSTASGRLRGTQEVTPSTPLTPTSHTANTSPRPVSGMERERKVSMRLHRGAPVNVSSSDLTGRQETSRMSTSQIPSRVASSGLPSTVHR
Donor tissue: tailbud