ORFeome > MGC75664 – XORFeome 2.0

MGC75664 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75664, mRNA (cDNA clone MGC:75664 IMAGE:5379875), complete cds
Gene Symbol: MGC75664
Gene ID: 394949
ORF gb_acc: MG132833
ORF ID: 10183

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064180

Library Location

Plate ID: GDExt11002
Well Location: B12

EST Sequences

Clone: MGC:75664 IMAGE:5379875
Trimmed Sequence: ATGTCGAAGGAGGAGCAGATTGGCAAGCAGATTGGCAAGCAGATAAAGAAATTTATGGAGGATTGTGCTGAGGTACCCCAAGACAAGAAGCTGATTGATTTCAATAGAGTTTTATATCCTAGTGTTTTATGCAGTGAGGAGACTTTTAAGGCTTTGGAATCCTTTGAGGCAAGAGAGGATGATCTGATGCTGGTTTCTTACCCTAAATGTGGAACCAATTGGTCTGTGAATCTACTGAATGACATAGTGAAGGCAGTGTGCAATAAAGACCCGTCACCCATCATTCCAATTCTAGAATTTGGAGCTCCTGACAAATTTGAGAAACTAAATCAAGAACCATCGCCGAGAGTTTTAGCAACACATTTACATTATGATAATATTCCCCAAAGGTTTTTCGATAAGAAACTGAAGATGATGGTTGTATTTCGGAACCCAAAAGACACAGCAGTATCATATTTTCATTTTTATAATAACAACCCAGTGCTTCCCAAATATAGTTCTTGGGATACATTTTTTGAAGATTTTATGAGTGGAAATGTTTGTTGGGGGTCATATTTTGATCATGCACTTGCGTGGAACAAACACATTGATGATGAAGGTGTTTTGATAATGACTTTTGAAGAAATGAAAGAGGACCTAAAGGCAGCAGTAAAGAAGATATCAAAGTTCTTTGGATTGAGTCTAAATGAGGAACAAACTCAAGAAGTTGCTGGAAAAGGCACATTCACAGCCATGAAAGAAAAAATGACTGAAACTAGGAAGGATTTTGCAAAGATATTTTTAAGAAAAGGTGAGGTTGGAGACTGGAAAAACCATTTCTCAGAAGCTCAGAGCCAAGAAATAGATGCCAAGTTTGAGGCGTGTTTAGCAGGAACCAAACTAGGAGAAATGCTGAAGTATAATGTGTATTGTAAATAG
Full Trace Sequence: gaaacacagagcaaacaacacattttctgaactttttgcaaactgcctttgcccaaaatgtcgaaggaggagcagattggcaagcagattggcaagcagataaagaaatttatggaggattgtgctgaggtaccccaagacaagaagctgattgatttcaatagagttttatatcctagtgttttatgcagtgaggagacttttaaggctttggaatcctttgaggcaagagaggatgatctgatgctggtttcttaccctaaatgtggaaccaattggtctgtgaatctactgaatgacatagtgaaggcagtgtgcaataaagacccgtcacccatcattccaattctagaatttggagctcctgacaaatttgagaaactaaatcaagaaccatcgccgagagttttagcaacacatttacattatgataatattccccaaaggtttttcgataagaaactgaagatgatggttgtatttcggaacccaaaagacacagcagtatcatattttcatttttataataacaacccagtgcttcccaaatatagttcttgggatacattttttgaagattttatgagtggaaatgtttgttgggggtcatattttgatcatgcacttgcgtggaacaaacacattgatgatgaaggtgttttgataatgacttttgaagaaatgaaagaggacctaaaggcagcagtaaagaagatatcaaagttctttggattgagtctaaatgaggaacaaactcaagaagttgctggaaaaggcacattcacagccatgaaagaaaaaatgactgaaactaggaaggattttgcaaagatatttttaagaaaaggtgaggttggagactggaaaaaccatttctcagaagctcagagccaagaaatagatgccaagtttgaggcgtgtttagcaggaaccaaactaggagaaatgctgaagtataatgtgtattgtaaataggccattcatgagagtggctgagggatttatgacgcttgtttggtaataaaaaaggttttgtcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSKEEQIGKQIGKQIKKFMEDCAEVPQDKKLIDFNRVLYPSVLCSEETFKALESFEAREDDLMLVSYPKCGTNWSVNLLNDIVKAVCNKDPSPIIPILEFGAPDKFEKLNQEPSPRVLATHLHYDNIPQRFFDKKLKMMVVFRNPKDTAVSYFHFYNNNPVLPKYSSWDTFFEDFMSGNVCWGSYFDHALAWNKHIDDEGVLIMTFEEMKEDLKAAVKKISKFFGLSLNEEQTQEVAGKGTFTAMKEKMTETRKDFAKIFLRKGEVGDWKNHFSEAQSQEIDAKFEACLAGTKLGEMLKYNVYCK
Donor tissue: tadpole