ORFeome > MGC75668 – XORFeome 2.0

MGC75668 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75668, mRNA (cDNA clone MGC:75668 IMAGE:5379946), complete cds
Gene Symbol: MGC75668
Gene ID: 394699
ORF gb_acc: MG132822
ORF ID: 10170

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC062490

Library Location

Plate ID: GDExt11002
Well Location: C11

EST Sequences

Clone: MGC:75668 IMAGE:5379946
Trimmed Sequence: ATGGCTTACAATGTTTCCCTCTCTGGACCTGGACCGTGGGGATTCCGTCTGCAAGGAGGAAAAGACTTTAACATGCCCTTGACCATCTCCAGAGTTACCCCAGGCAGTAAAGCAGCACAGTCCAGTGTAAACCAGGGTGACTTAGTAGTTGCTATCGATGGAGTCAACACAGATGGCATGACTCATTTAGAGGCTCAGAACAAGATTAAATCTGCCAGCTACAACTTGGGTCTCACACTTCAAAAATCAAAGCGTCCTGGACCAGTTCCCACAGCCACCCCGCGAATGGATTCCCCAATGCCAGTGATCCCTCATCAAAAGGTTATAGCCAACACTGTTGCCAACTCTGAGTTTGTGGAACGCTTCAACCCCAATGTGCTGAAAGACTCTGCCCTCTCCACCCACAAACCTATTGAGGTGAAGGGTCCAGGAGGGAAAGCCACTATTATTCATGCACAGTATAACACCCCAATCAGCATGTATTCCCAGGATGCCATTATGGATGCTATTGCTGGCCAAGCACAGGCCAGAGGCAGTGAGATGTCTAGTGGCTCTGAATCTCAACTGGTTAACCTCCCTGTTAAAGATCCTCTCGTAGACATTGCTTCTCCAGTGTATCAGGCTGTGCTTAAAAATCAGGGCAAAACTGAGAGTGAAATTGATGACTGGGCACGTCGTGCTGCCAATCTGCAGTCTAAGTCCTTCCGTGTCCTTGCACATATCACTGGAACAGAATACATGCAAGATCCTGATGAAGATGCATTGAGAAGAGCAAGGGAAAAGTTTGAAACGGAACGTAACAGCCCACGCTTTGCCAAATTGCGCACCTGGCATCACGGCCTTTCGGCAAAAATGCTTAATGTCAAAAGTTAA
Full Trace Sequence: ctgcagaacagctcccagagcctttgagtggctgtgctaaaaatctgtaaaaatggcttacaatgtttccctctctggacctggaccgtggggattccgtctgcaaggaggaaaagactttaacatgcccttgaccatctccagagttaccccaggcagtaaagcagcacagtccagtgtaaaccagggtgacttagtagttgctatcgatggagtcaacacagatggcatgactcatttagaggctcagaacaagattaaatctgccagctacaacttgggtctcacacttcaaaaatcaaagcgtcctggaccagttcccacagccaccccgcgaatggattccccaatgccagtgatccctcatcaaaaggttatagccaacactgttgccaactctgagtttgtggaacgcttcaaccccaatgtgctgaaagactctgccctctccacccacaaacctattgaggtgaagggtccaggagggaaagccactattattcatgcacagtataacaccccaatcagcatgtattcccaggatgccattatggatgctattgctggccaagcacaggccagaggcagtgagatgtctagtggctctgaatctcaactggttaacctccctgttaaagatcctctcgtagacattgcttctccagtgtatcaggctgtgcttaaaaatcagggcaaaactgagagtgaaattgatgactgggcacgtcgtgctgccaatctgcagtctaagtccttccgtgtccttgcacatatcactggaacagaatacatgcaagatcctgatgaagatgcattgagaagagcaagggaaaagtttgaaacggaacgtaacagcccacgctttgccaaattgcgcacctggcatcacggcctttcggcaaaaatgcttaatgtcaaaagttaaatgcccaagtgtaacacaatatctactgaaaggcaatgaagcacactaaattgtactatatcactaagcattaatgacttgccatatacataaatatataaatatataaatagaaaccacctgagatgtttaaaaaaaaaaaaaaaaaaaaaa
Translation: MAYNVSLSGPGPWGFRLQGGKDFNMPLTISRVTPGSKAAQSSVNQGDLVVAIDGVNTDGMTHLEAQNKIKSASYNLGLTLQKSKRPGPVPTATPRMDSPMPVIPHQKVIANTVANSEFVERFNPNVLKDSALSTHKPIEVKGPGGKATIIHAQYNTPISMYSQDAIMDAIAGQAQARGSEMSSGSESQLVNLPVKDPLVDIASPVYQAVLKNQGKTESEIDDWARRAANLQSKSFRVLAHITGTEYMQDPDEDALRRAREKFETERNSPRFAKLRTWHHGLSAKMLNVKS
Donor tissue: tadpole