ORFeome > MGC75675 – XORFeome 2.0

MGC75675 – XORFeome 2.0

General Information

Species: Xenopus tropicalis DnaJ homolog subfamily B member 6, mRNA (cDNA clone MGC:75675 IMAGE:5380076), complete cds
Gene Symbol: MGC75675
Gene ID: 394712
ORF gb_acc: MG132854
ORF ID: 10208

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC062492

Library Location

Plate ID: GDExt11003
Well Location: D01

EST Sequences

Clone: MGC:75675 IMAGE:5380076
Trimmed Sequence: ATGGTGGAGTATTACGATGTCCTGGGAGTCCAGAGGAACGCCTCTCCAGAAGATATTAAGAAAGCATACCGCAAGCTAGCCTTAAAGTGGCACCCAGACAAGAACCCCGACAATAAAGATGAAGCCGAGAGGAGGTTCAAAGAAGTTGCTGAAGCTTATGAGGTCCTGTCAGATTCTAAAAAGAGGGATATTTATGATAAATATGGAAAAGAAGGATTGACAGGTGGTGGAGGCGGCAGTCACTTTGATAATCCATATGAGTTTGGATTTACATTCCGAAGCCCAGACGATGTTTTCAGGGATTTCTTTGGGGGAAGAGACCCATTTTCATTTGATTTATTTGCTGACGATCCATTTGATGACTTCTTTGGCAGAAGAGGCCACAGAGCAAACAGAAGCAGGCCAGGGGGTTCCTTTCTCTCTACGTTTGGAGGTTTCCCTGCCTTTGGTCCTACCTTCTCTCCATTTGACTCGGGTTTCAGTTCTTCATTTGGTTCTTTTGGTGGACATGGTGGTTTCTCTTCATTTTCCTCTTCATCGTTTGGCGGTTCAGGAATGGGTAACTTCAGATCTGTATCAACCTCAACTAAAGTAGTTAACGGAAGAAGAGTTACAACAAAGAGAATTGTTGAAAATGGACAAGAGCGCATTGAAGTAGAAGAAGACGGGCAGTTAAAGTCCTTAACAATAAATGGTAAGGAGCAGCTGCTTCGCTTGGATAACAAGTAA
Full Trace Sequence: acattactgagccatggtggagtattacgatgtcctgggagtccagaggaacgcctctccagaagatattaagaaagcataccgcaagctagccttaaagtggcacccagacaagaaccccgacaataaagatgaagccgagaggaggttcaaagaagttgctgaagcttatgaggtcctgtcagattctaaaaagagggatatttatgataaatatggaaaagaaggattgacaggtggtggaggcggcagtcactttgataatccatatgagtttggatttacattccgaagcccagacgatgttttcagggatttctttgggggaagagacccattttcatttgatttatttgctgacgatccatttgatgacttctttggcagaagaggccacagagcaaacagaagcaggccagggggttcctttctctctacgtttggaggtttccctgcctttggtcctaccttctctccatttgactcgggtttcagttcttcatttggttcttttggtggacatggtggtttctcttcattttcctcttcatcgtttggcggttcaggaatgggtaacttcagatctgtatcaacctcaactaaagtagttaacggaagaagagttacaacaaagagaattgttgaaaatggacaagagcgcattgaagtagaagaagacgggcagttaaagtccttaacaataaatggtaaggagcagctgcttcgcttggataacaagtaaattcaacgcacgcatgtatcagagttattaacttaaacaagcaccatttgtggagtatcaggaacatttttgaagatttcaaaagaactgctcagattttatctgtacttatctgacatatttataagaagctcgttggagttcctgatatttgtcatagacaattttgggaccatgctcataggaccatttttttttcatttttttttttttaaatatcgtaattttctgtatgcacttttaaaaaaaaaaaaaaaaaa
Translation: MVEYYDVLGVQRNASPEDIKKAYRKLALKWHPDKNPDNKDEAERRFKEVAEAYEVLSDSKKRDIYDKYGKEGLTGGGGGSHFDNPYEFGFTFRSPDDVFRDFFGGRDPFSFDLFADDPFDDFFGRRGHRANRSRPGGSFLSTFGGFPAFGPTFSPFDSGFSSSFGSFGGHGGFSSFSSSSFGGSGMGNFRSVSTSTKVVNGRRVTTKRIVENGQERIEVEEDGQLKSLTINGKEQLLRLDNK
Donor tissue: tadpole