ORFeome > MGC75676 – XORFeome 2.0

MGC75676 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ADP-ribosylation factor-like 2, mRNA (cDNA clone MGC:75676 IMAGE:5380094), complete cds
Gene Symbol: MGC75676
Gene ID: 394753
ORF gb_acc: MG132867
ORF ID: 10224

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061604

Library Location

Plate ID: GDExt11003
Well Location: D05

EST Sequences

Clone: MGC:75676 IMAGE:5380094
Trimmed Sequence: ATGGGCTTACTAACTATTCTTAAGAAAATGAAGCAGAAGGAGCGGGAGGTTCGGCTACTCATGCTAGGTTTAGATAATGCCGGTAAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGA
Full Trace Sequence: gcagttctgacaggagacctgggcaaggagaaagcgtctgagcatcatgggcttactaactattcttaagaaaatgaagcagaaggagcgggaggttcggctactcatgctaggtttagataatgccggtaaaacgaccatcctaaagaagtttaatggcgaggatatcaacaccatttctccaacacttggattcaacatcaaaacgctggagcacagagggtttaagctgaatatgtgggatgtgggcggtcaaaagtccttacggtcatactggagaaactactttgagagcacagatgggctgatctgggtggttgacagtgctgaccgtgcacggttgcaggattgtgctcaagaactagctgggctgctgttggaggagcgactggctggagcaacattgcttgtattcgccaacaaacaagacttgcctggagccttatctaaagatgcaatcaaagaggccctggagttggataacataaagacacatcactggtgtatccaaggctgcagtgcagtgactggggaaaatctcctgactggcattgattggttgttggatgatatatccagtcgcatttttacagctgactgaagcagaatgggaagcaaagaagagaaggaccttaaggagcatcttatttattttaacaatggcttgactaatgcagagtcttgactggctatgactgatctagggaataacagagaggtgtgccctcccatggctgatacgcaaatgggagatttgtaaggatacagagttggaaccttgtggttaaaagaaccgtcactggtacaaagagcggcagaatatgctgttctgtcgcagagacaataaattctcatcatttaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGLLTILKKMKQKEREVRLLMLGLDNAGKTTILKKFNGEDINTISPTLGFNIKTLEHRGFKLNMWDVGGQKSLRSYWRNYFESTDGLIWVVDSADRARLQDCAQELAGLLLEERLAGATLLVFANKQDLPGALSKDAIKEALELDNIKTHHWCIQGCSAVTGENLLTGIDWLLDDISSRIFTAD
Donor tissue: tadpole