ORFeome > MGC75678 – XORFeome 2.0

MGC75678 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75678, mRNA (cDNA clone MGC:75678 IMAGE:5380126), complete cds
Gene Symbol: MGC75678
Gene ID: 394682
ORF gb_acc: MG132862
ORF ID: 10216

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC062493

Library Location

Plate ID: GDExt11002
Well Location: B10

EST Sequences

Clone: MGC:75678 IMAGE:5380126
Trimmed Sequence: ATGAATTCACCCATGAAGGTTACGAGAGAAAACATTGTTGAGTTCCTGGCCGAAAGGTTCAATCGGCTCCCAGAAAATGAGAGGAAACTCTTTACCTACGGATCCATTTACATGGGAATAAACAGCGCATTCGCCGGCCTCATAGCCAATAGCCTGTTTAGGCGCATCCTCCACGTCTCCCAGGCTTGGGTCTCATCCAGTTTACCGATGGCGGTTTTGCCGTTCCTGACTTCGGTGGCGCTGTACAACGCTACGGTGACCACCCCCATGCTTTCAGGTGACCTGAATTGTGCCACCTGTACCGTAGTGAGGGGTGGATTGGTCGGCACCGTTGCTGGAGGCCTGTACCCAATTCTTTTGGCTTTGCCTGTGAACGGAGGACTTGCTGCCCGGTACCAGACAACCCCTTTGCCAGAGAAAGGGAACATCTTGCGCTTCTGGACCACCGTATCCCGGCCAGTCCTGAGAAAGATGAGCTTCGTCTTGATCCTTCAGGCCATGTTTGGTGTTTACATCAGCACCCGCCATTATGCAATATACGAGCAAATGCTGAAGTTGCCGCCCCCTGGGACTGACATGGAGGAGCTGCCACAGTAA
Full Trace Sequence: cgctgcgcgtcatgtgacaggcaagatggcggcgcccagggaggaacgcggagtgtgaggtcggtgctgccggtgggactaatcccggggcttccggggcggatacacctcactggcccctgtgggactggcgggaagggaatatcagaaagtcggagagcacaagcagcacagagagtgaccccctcaagatgaattcacccatgaaggttacgagagaaaacattgttgagttcctggccgaaaggttcaatcggctcccagaaaatgagaggaaactctttacctacggatccatttacatgggaataaacagcgcattcgccggcctcatagccaatagcctgtttaggcgcatcctccacgtctcccaggcttgggtctcatccagtttaccgatggcggttttgccgttcctgacttcggtggcgctgtacaacgctacggtgaccacccccatgctttcaggtgacctgaattgtgccacctgtaccgtagtgaggggtggattggtcggcaccgttgctggaggcctgtacccaattcttttggctttgcctgtgaacggaggacttgctgcccggtaccagacaacccctttgccagagaaagggaacatcttgcgcttctggaccaccgtatcccggccagtcctgagaaagatgagcttcgtcttgatccttcaggccatgtttggtgtttacatcagcacccgccattatgcaatatacgagcaaatgctgaagttgccgccccctgggactgacatggaggagctgccacagtaattgttttgtatatatatatatttgcaaggggctgtctaaaaagtgagataataaacttgtatgtaaacattaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MNSPMKVTRENIVEFLAERFNRLPENERKLFTYGSIYMGINSAFAGLIANSLFRRILHVSQAWVSSSLPMAVLPFLTSVALYNATVTTPMLSGDLNCATCTVVRGGLVGTVAGGLYPILLALPVNGGLAARYQTTPLPEKGNILRFWTTVSRPVLRKMSFVLILQAMFGVYISTRHYAIYEQMLKLPPPGTDMEELPQ
Donor tissue: tadpole