ORFeome > MGC75686 – XORFeome 2.0

MGC75686 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75686, mRNA (cDNA clone MGC:75686 IMAGE:5380242), complete cds
Gene Symbol: MGC75686
Gene ID: 394492
ORF gb_acc: MG132882
ORF ID: 10245

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC059734

Library Location

Plate ID: GDExt11003
Well Location: F02

EST Sequences

Clone: MGC:75686 IMAGE:5380242
Trimmed Sequence: ATGGGAGACAAGAAGAGTCCGACCAGGCCGAAGAGGCAGCCGAAGCCTTCATCAGACGAAGGATACTGGGACTGTAGCGTGTGCACTTTTAAGAACAGCGCCGAGGCCTTCAAGTGCCTGATGTGCGATGTACGCAAGGGAACCTCTACCCGAAAACCTCGACCTGTTTCCCAGTTGGTTGCACAACAAGTAACCCAGCAGTTTGTGCCTCCCATGCAAACAAAGAAAGAGAAAAAAGATAAAATTGAGAAGGAAAAGAGTGAAAAGGAAACCATGATCAAGAAGAATAGCCATAAGAAGACAAGGCCACGATTAAAAAATGTGGATAGAAGCAGTGCCCAACATTTGGAGGTTACAGTTGGTGATCTGACAGTCATTATTACAGACTTTAAGGAGAAAACTAAGTCACCTCCCACATCCAGTGCTACGTGCGCGGATCAGCACAGTCAAAGTGGCTCTGGCTCTGAAAACACAGAGAGAGGGATATCCAGGTCATCTTCACCTAGAGGAGAAGCTTCATCCATCAATGGAGAATCCCATTAA
Full Trace Sequence: ctgcggttgatcgcggtcggtgtaggcgcccactcccgcctcatagcccgggctctctccccgctcggcctgcgctcagcttcctctgaagcagcatgggagacaagaagagtccgaccaggccgaagaggcagccgaagccttcatcagacgaaggatactgggactgtagcgtgtgcacttttaagaacagcgccgaggccttcaagtgcctgatgtgcgatgtacgcaagggaacctctacccgaaaacctcgacctgtttcccagttggttgcacaacaagtaacccagcagtttgtgcctcccatgcaaacaaagaaagagaaaaaagataaaattgagaaggaaaagagtgaaaaggaaaccatgatcaagaagaatagccataagaagacaaggccacgattaaaaaatgtggatagaagcagtgcccaacatttggaggttacagttggtgatctgacagtcattattacagactttaaggagaaaactaagtcacctcccacatccagtgctacgtgcgcggatcagcacagtcaaagtggctctggctctgaaaacacagagagagggatatccaggtcatcttcacctagaggagaagcttcatccatcaatggagaatcccattaatttttttttctccacccgtttttctgttcactcgaacatcttctggcagtagttaaaacgttttcatgaaaagaatgacctaatgaaaaactggtatttttttaatagttaagtatgcacttattttcttatttgtgcatttataggtgcaccattaaatttcacatacagttgggagtctggtccaaagtcagcctgtaaacatattaagactgtcatatctttagttttcacatataatatgtgaaaagtaaacagaaaataaaccttacctttttgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGDKKSPTRPKRQPKPSSDEGYWDCSVCTFKNSAEAFKCLMCDVRKGTSTRKPRPVSQLVAQQVTQQFVPPMQTKKEKKDKIEKEKSEKETMIKKNSHKKTRPRLKNVDRSSAQHLEVTVGDLTVIITDFKEKTKSPPTSSATCADQHSQSGSGSENTERGISRSSSPRGEASSINGESH
Donor tissue: tadpole