ORFeome > MGC75754 – XORFeome 2.0

MGC75754 – XORFeome 2.0

General Information

Species: Xenopus tropicalis transmembrane 4 superfamily member 10, mRNA (cDNA clone MGC:75754 IMAGE:5381561), complete cds
Gene Symbol: MGC75754
Gene ID: 394494
ORF gb_acc: MG132919
ORF ID: 10285

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC059749

Library Location

Plate ID: GDExt11003
Well Location: A06

EST Sequences

Clone: MGC:75754 IMAGE:5381561
Trimmed Sequence: ATGGCTTCTTCAGCCAGCGGGATGGAGGAGGTTCGTTCTTCTGTTTTGACCCCTCTAAAGCTGGTGGGACTGGTCTGCATCTTCCTGGCACTATGTCTGGATATCGGAGCCGTTCTGAGCCCAGCCTGGGTGACGGCGGACAACCAATACTATCTGTCATTATGGGAGTCTTGCAAGAAAGCTGAAAACCTCTGGATATGCGATTCTACCCTGGAGAGCGACTGGCAGATTGCTACTCTTGCCTTACTTTTAGGCGGCGCTGCTATCATACTAATCGCCTTCCTTGTGGGCCTGATCTCCATCTGCGTGGGATCCCGTAGGCGGTTCTACAGACCGGTGGCAGTGATGCTTTTCGCAGCAGTTGTTCTCCAGGTCTGCGGTCTCGTATTGTACCCAATCAAATTCATCGAAACAGTCACTTTAAAGATATACCATGAATTCAACTGGGGATATGGACTGGCCTGGGGTGCAACTATTTTTTCTTTTGGAGGTGCCATACTTTACTGCCTGAATCCTAAGAATTATGAGGATTACTACTAA
Full Trace Sequence: gtcttgtgttgctgctgatcaggggtggggaccatggcttcttcagccagcgggatggaggaggttcgttcttctgttttgacccctctaaagctggtgggactggtctgcatcttcctggcactatgtctggatatcggagccgttctgagcccagcctgggtgacggcggacaaccaatactatctgtcattatgggagtcttgcaagaaagctgaaaacctctggatatgcgattctaccctggagagcgactggcagattgctactcttgccttacttttaggcggcgctgctatcatactaatcgccttccttgtgggcctgatctccatctgcgtgggatcccgtaggcggttctacagaccggtggcagtgatgcttttcgcagcagttgttctccaggtctgcggtctcgtattgtacccaatcaaattcatcgaaacagtcactttaaagatataccatgaattcaactggggatatggactggcctggggtgcaactattttttcttttggaggtgccatactttactgcctgaatcctaagaattatgaggattactactaaacctgggctgtaaatgaagaaatgaaaaacaggactattcaacttttttttctatctccgttttctagaacacatatggagcataaagcaatctgcacagttgatttaatcacttttgcctttcggctgccaataatataaccagctttacatccactttcaaaaactgccgaacataaagcaaagagtgggaaaaggaatccgcggataactgcataggtgactgctgaaatctgttgctatcttaacagactacacaaacataatcatggtataaatagttaattgcaaataaaatgacaataaccaccaaatgcatctgccgccaagatctgtataaaatcttaccactgcattgtgctgctgagttttgctcaatagtgtgctgcagagattggattctggtgaatagaaagcttaataatgcttgttcttcaaccaaaaaaaaaaaaaaaaaaaaa
Translation: MASSASGMEEVRSSVLTPLKLVGLVCIFLALCLDIGAVLSPAWVTADNQYYLSLWESCKKAENLWICDSTLESDWQIATLALLLGGAAIILIAFLVGLISICVGSRRRFYRPVAVMLFAAVVLQVCGLVLYPIKFIETVTLKIYHEFNWGYGLAWGATIFSFGGAILYCLNPKNYEDYY
Donor tissue: tadpole