ORFeome > MGC75853 – XORFeome 2.0

MGC75853 – XORFeome 2.0

General Information

Species: Xenopus tropicalis phosphatidylinositol transfer protein, beta, mRNA (cDNA clone MGC:75853 IMAGE:5382749), complete cds
Gene Symbol: MGC75853
Gene ID: 394727
ORF gb_acc: MG133038
ORF ID: 10433

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061334

Library Location

Plate ID: GDExt11004
Well Location: G08

EST Sequences

Clone: MGC:75853 IMAGE:5382749
Trimmed Sequence: ATGGTGCTGATCAAGGAATACCGTGTTTTGCTGCCTGTGTCAGTGGAAGAGTACCAGGTGGGGCAGCTCTTCTCTGTGGCCGAGGCCAGTAAAGATAACACGGGCGGAGGGGAAGGGATCGAAGTCCTTAAGAATGAGCCGTATGAGCTGGATGGGGAGAAAGGGCAATACACCCACAAGATCTACCACTTACAGAGTAAAGTCCCTGGTTTTGTTAAGATGGTGGCGCCAGAAGGTTCCCTAGTGTTTCATGAGAAAGCCTGGAACGCCTACCCCTACTGCCGCACCATCGTCACGAATGAATATATGAAAGATAATTTCTTCGTGAAGATTGAGACCTGGCACAAACCGGACTTTGGGGACCAGGAAAATGTGCACGGACTGGACAGCAACACTTGGAAAGAGGTAGAAGTCGTGCCCATTGACATCGCTGATAACTCCCAGATAAACGAGGGGGATTACAAAGCCAATGAGGATCCCGCTTGCTACAGGTCGGAGAAGACGGGCCGAGGACCCTTGAAGCAGGATTGGAAGAAGGAGTTGGCCAACAACCCGTCGTGCCCTCACATGTGTGCCTACAAGCTGGTGACGGTGAAGTTCCAGTGGTGGGGCCTTCAGGGCAAAGTGGAGAGGTTTATTCACAAGCAAGAGAAGCGCCTTTTCACCAACTTCCACCGACAGCTTTTCTGCTCGTTGGACCGGTGGGTGGAGCTGACCATGGAAGACATCCGCCGGATGGAAGACGAGACACAGAAGGAACTCGACGAGATGCGACAGAAAGGAGCGGTCCGGGGAATGTCGGCCAAGGATGAATAA
Full Trace Sequence: gagacacggagggagccgaagatggtgctgatcaaggaataccgtgttttgctgcctgtgtcagtggaagagtaccaggtggggcagctcttctctgtggccgaggccagtaaagataacacgggcggaggggaagggatcgaagtccttaagaatgagccgtatgagctggatggggagaaagggcaatacacccacaagatctaccacttacagagtaaagtccctggttttgttaagatggtggcgccagaaggttccctagtgtttcatgagaaagcctggaacgcctacccctactgccgcaccatcgtcacgaatgaatatatgaaagataatttcttcgtgaagattgagacctggcacaaaccggactttggggaccaggaaaatgtgcacggactggacagcaacacttggaaagaggtagaagtcgtgcccattgacatcgctgataactcccagataaacgagggggattacaaagccaatgaggatcccgcttgctacaggtcggagaagacgggccgaggacccttgaagcaggattggaagaaggagttggccaacaacccgtcgtgccctcacatgtgtgcctacaagctggtgacggtgaagttccagtggtggggccttcagggcaaagtggagaggtttattcacaagcaagagaagcgccttttcaccaacttccaccgacagcttttctgctcgttggaccggtgggtggagctgaccatggaagacatccgccggatggaagacgagacacagaaggaactcgacgagatgcgacagaaaggagcggtccggggaatgtcggccaaggatgaataaaccccccctgtcccacactcacggattcccctcagctggagcctgtcctctctccctcctctcatctgctggatggagcctgggcacatttggatgtgggatgaagagctgatggaacctcgctctttctcagctccctgctacatcctccacctttgttgacctttctggttcccttccatttctccatctgtccctgttttcctctctggttctctggaacagaactctgcagcaccttggtcttctctgcacgaatggaaaggggtgccacttctcaggggtttgtgggtgtacaggtgttgtgcccccttggttgaaagtggcatcagactttgaggggagagataagtgctctaatatgtggcaccgagcccccggccatcagagacttcccctgctggaggtgggagagttgcttaggggtctcaccgcaatcaagcaccatggaatgtgttgataccccccccccccccttggggcaggtggttgtgcagaagcagaggaagggggcaatgcatcatatcactccctcttgggcaagttcttcactcattgatttgtttcgtacttcagggtccagaagcatgagcgaaggggagtccttcggggagggtaaatggatgagggctgcgatcttgccttgggccagaggacagaggggttggtagattttttttggttttctgtttccttttatgttttttaaaggcatcacgataacatttattgaaataaacaaagacgagaagaaaaaaaaaaaaaaa
Translation: MVLIKEYRVLLPVSVEEYQVGQLFSVAEASKDNTGGGEGIEVLKNEPYELDGEKGQYTHKIYHLQSKVPGFVKMVAPEGSLVFHEKAWNAYPYCRTIVTNEYMKDNFFVKIETWHKPDFGDQENVHGLDSNTWKEVEVVPIDIADNSQINEGDYKANEDPACYRSEKTGRGPLKQDWKKELANNPSCPHMCAYKLVTVKFQWWGLQGKVERFIHKQEKRLFTNFHRQLFCSLDRWVELTMEDIRRMEDETQKELDEMRQKGAVRGMSAKDE
Donor tissue: neurula