ORFeome > MGC75872 – XORFeome 2.0

MGC75872 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75872, mRNA (cDNA clone MGC:75872 IMAGE:5383015), complete cds
Gene Symbol: MGC75872
Gene ID: 394774
ORF gb_acc: MG133033
ORF ID: 10425

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC063349

Library Location

Plate ID: GDExt11004
Well Location: G11

EST Sequences

Clone: MGC:75872 IMAGE:5383015
Trimmed Sequence: ATGTTCCACAGAAAGCACCTCAAGCTTCTTCTCATTGGGAATGCAGGATCAGGAAAGTCAGCACTGATGAACCAGTATGTCAACTGTCGCTTTACCAACTACTACCGAGCCACTATCGGTGCAGATTTCTTCACCAAGGAGCTACGAGTTAATGATAAGGTGGTGACAGTGCAGATATGGGATACAGCAGGCACAGAGCGCTTTCAGTCACTGGGTGCCGCTCTCTATAGAGGCACAGACTGCTGCCTGTTGGTTTTTGATGTGACCTCCCCTAACTCCTTCCATGCTCTGGATAACTGGCACAGAGAGTTTCTGGTGCAAGCGGATCCAGTTTCTCCTGGCAGTTTCCCTTTCGTGGTGATCGGTAACAAGACAGACCTTGAGGAGCGGCAGGTTTCACTGCGGGAGGCAGAGGAATGGTGTAAAACGTACAATGCAAAGTACTTTGAAACCAGCGCTAAGGAATCACGGAATGTGGATGAGGCCTTCCTAGAAGCCATCAAATTAGCCTTTAACAATCACCAGGAGCCTGACCAGAACTGGGAGACCAAGGTAGTAAACTTGTCTCCTCCGAGCAACAGTAAGAAATGTGACTGTTAG
Full Trace Sequence: ctctgtaaacctgcagccctgccagctggagaaagaaatcactaagagctcctcctagctatcatcccaccctcttttctctgaaaggcttcggccatgttccacagaaagcacctcaagcttcttctcattgggaatgcaggatcaggaaagtcagcactgatgaaccagtatgtcaactgtcgctttaccaactactaccgagccactatcggtgcagatttcttcaccaaggagctacgagttaatgataaggtggtgacagtgcagatatgggatacagcaggcacagagcgctttcagtcactgggtgccgctctctatagaggcacagactgctgcctgttggtttttgatgtgacctcccctaactccttccatgctctggataactggcacagagagtttctggtgcaagcggatccagtttctcctggcagtttccctttcgtggtgatcggtaacaagacagaccttgaggagcggcaggtttcactgcgggaggcagaggaatggtgtaaaacgtacaatgcaaagtactttgaaaccagcgctaaggaatcacggaatgtggatgaggccttcctagaagccatcaaattagcctttaacaatcaccaggagcctgaccagaactgggagaccaaggtagtaaacttgtctcctccgagcaacagtaagaaatgtgactgttagagagtgcagacagaagaactgtagccacagtgcctgcctggctcgagaggattctgcccaggtacaggcacttgcaggaaggcccagccagcaccgccatcactcaggatcacagcgtgtaagtggaaggatggagaggagcagccagatcctgtttacttaaacaccagtttgtaagaacttgtcaaactggtcaaggctacgtgaagcctacctctacctgccgactgagctgcgccacagggaccctgggggacatttactttttatctggaatttctcagctaaaacaaaaaaaaaaagagaaaggactttatatttgtcccaccacaaagttatcatctctatatgcatttatcaaaatgaccatttaaaaaaaccatgctccaggaccacccccaatctgcctgtaaccccaccaacgtcccattaagtactgccagttatacacaggcaaatgactgaactttgccagcacacagggcagtcattgggtgggtggtttggtagaaaggggctggaactctggaaacgtgatttatacacggcctggacctgaaatgctagaacatggtatggaggaagcaggagcatcaggagaacattttagagtttcagtattaactcaaatcccggctttaggctcatttaagaaagggtggggggaggtttaaaaactggccacttatgttgcatttttatttttcacaatttttaaaaaaaaataacattaaatgttttacaatttgtgttaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MFHRKHLKLLLIGNAGSGKSALMNQYVNCRFTNYYRATIGADFFTKELRVNDKVVTVQIWDTAGTERFQSLGAALYRGTDCCLLVFDVTSPNSFHALDNWHREFLVQADPVSPGSFPFVVIGNKTDLEERQVSLREAEEWCKTYNAKYFETSAKESRNVDEAFLEAIKLAFNNHQEPDQNWETKVVNLSPPSNSKKCDC
Donor tissue: neurula