ORFeome > MGC75903 – XORFeome 2.0

MGC75903 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75903, mRNA (cDNA clone MGC:75903 IMAGE:5383531), complete cds
Gene Symbol: MGC75903
Gene ID: 394605
ORF gb_acc: MG132999
ORF ID: 10384

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061355

Library Location

Plate ID: GDExt11004
Well Location: E07

EST Sequences

Clone: MGC:75903 IMAGE:5383531
Trimmed Sequence: ATGGCGGCGGAGAGTTTTGCCGAGGCTTTGCAGAGACTGAAGGAGATTCATGACAAGGAGGTGCTGGGTATGCAGGCAAAACTTTCAGATCTGACAATGGAAAAGTGCCGTGACGCACAGAGAATCGAGGAGCTGTTTTCCAAGAACCACCTACTGCGGGAACAGCACAAGGTCCTCAATGAAAATATCAAAGTGCTGGAGAACAGGTTGAGGGCCGGATTGTGTGACCGATGCACAGTAACACAGGAGTTGGCCAAAAAGAAACAACAGGAGTTCGAGAGTTCCCACTTACACAGCCTGCAGCAGATCTCTGGCCTCACCAATGAAATGAAAAGTTTAAAGGAAGAAAACCGATCCCTTCTGGAGGAGCTGAAGAAGCAACAGTGTTTGGACAACAAACACCACCAAGCCTTTTCCCCAGAAATCAAGGCCGGGCCGGACTCCCCGCGAACGCTGTCGGCCTCCATAAGTCAGAGGAACGGAGTGGAGAAATCAAGTAGAGAGGAAGAGTCACCGGAGCGCGCGTCTGATCCTCAGGTTTCAGAAGAGAAATATCCTGTGGCGGCCAAACTCTCTCCGGGAGGAAAGACACCACACATCCTAGGTCCTGAGACTCACATCCAGGAGAACCACATTCCCATGGCACAGAAGATATACCTAAGCTCACTGAACCAGCAGAAAATCTCCAATCAGCTTCACGGGACCATCGCGGTGCTGAGACCAGGTTTCCGGAGCGGACGTGCTGGAATACCATCCTCCCTTAATAAACGGGCTTCAAGCAATGAAATGTTTCCCAAGGCAAGTGGTGTGGATCCCAATGATGCCTCATCACAGCTTGACTCTCTAAAACATATCCCAGAAGAGCAAATGTGTTTCCTGCGACAACATCTGGCACAAAGGCGGCTCGGCCCACAAGCTCCTGTAGCCATGGGAGATGGACGCTGTATTCTAACCAAAGGCCAAGACACAGAGGCCACCAGGAAAGTTCCCCAAGATGATTGGGATGAGAGGGTAGCGATGGCCGAGCTCCATGGTGCTATGATGTTCCTGAGAGACCGTGGGTTTAGAGGAAGGGTGTTACACCCAGACCAGAGAGACAGGCTTAATTACATTCTGACCAGACAACACCAAGGACAGAGGTCACCAAAATCCCCAGGTGATGTTCCAGCTTCTCAACGAAGAGACAGCATTGATGAAGGAGAGCTGTCGCTGCTCCATATGCTTAGCGCTCGCTGGAAGAACAAGCAGCATGAAAGCCAGACTGAGGAGAAGGAACCGGATATGAAAGAGCCAAAGTACGAAGTACCCGAGAAGAGGCAACAAGACGAGCCAACGCCAGATAAGCCCCTCGATCTATCTGATGCCAGGCGAGGGCAGCCAAGCTACTGGCCGGGCAGCCAAAGAGAACAGAGAGGGCCACACGAAGGGTATAGCACAAGCCCAACTTTCACAAATAACTTCTCTCCTCAAGCCGCGAATACTGATGTAAGGGGCTCAGAAGAGAGCAGGTTGTTGGGGAGTCTAGTGAAGGAAGAAAACGCTTGCAACGAGGAGGAAGTCACCAAAGATATGAAAAGGAATTCTTCCCCTTCCGCCGACAAAGAAAGAGACGGAATATCTGGCAAAAGATCGACACGGGGGCATAAAAGAGAAAGATCTCTGGAAACAGATTTGGAGGAAGAGGAGGACCTGGAGAAGGACGAGCAGTCGCCCCAAATGGATTTCAATGAGATGGAAACATCTGACAGTGAGCCTGAAACAGAAAGCACCCACCTTGCTCTAAATGAGGGGCAGCGGGACGGCTTCATCAAGGACAGGATTATCCGAAAACACAAATGGACCAAGAAGGGGCATCAAGGGGCAGTGTCAAGCAAATATATGAAAAGGAAGAAGAAAGCTCTTCTAACAGAGAGTGACGCTTCCCAAGAATAA
Full Trace Sequence: tccgaggttccaggctggatccggaggcgccgaatgcgagggaaatgtcaagaagtcgattgctgtagtgctgagctgaaataaagaggcggccatttttgaaaccaaaatggcggcggagagttttgccgaggctttgcagagactgaaggagattcatgacaaggaggtgctgggtatgcaggcaaaactttcagatctgacaatggaaaagtgccgtgacgcacagagaatcgaggagctgttttccaagaaccacctactgcgggaacagcacaaggtcctcaatgaaaatatcaaagtgctggagaacaggttgagggccggattgtgtgaccgatgcacagtaacacaggagttggccaaaaagaaacaacaggagttcgagagttcccacttacacagcctgcagcagatctctggcctcaccaatgaaatgaaaagtttaaaggaagaaaaccgatcccttctggaggagctgaagaagcaacagtgtttggacaacaaacaccaccaagccttttccccagaaatcaaggccgggccggactccccgcgaacgctgtcggcctccataagtcagaggaacggagtggagaaatcaagtagagaggaagagtcaccggagcgcgcgtctgatcctcaggtttcagaagagaaatatcctgtggcggccaaactctctccgggaggaaagacaccacacatcctaggtcctgagactcacatccaggagaaccacattcccatggcacagaagatatacctaagctcactgaaccagcagaaaatctccaatcagcttcacgggaccatcgcggtgctgagaccaggtttccggagcggacgtgctggaataccatcctcccttaataaacgggcttcaagcaatgaaatgtttcccaaggcaagtggtgtggatcccaatgatgcctcatcacagcttgactctctaaaacatatcccagaagagcaaatgtgtttcctgcgacaacatctggcacaaaggcggctcggcccacaagctcctgtagccatgggagatggacgctgtattctaaccaaaggccaagacacagaggccaccaggaaagttccccaagatgattgggatgagagggtagcgatggccgagctccatggtgctatgatgttcctgagagaccgtgggtttagaggaagggtgttacacccagaccagagagacaggcttaattacattctgaccagacaacaccaaggacagaggtcaccaaaatccccaggtgatgttccagcttctcaacgaagagacagcattgatgaaggagagctgtcgctgctccatatgcttagcgctcgctggaagaacaagcagcatgaaagccagactgaggagaaggaaccggatatgaaagagccaaagtacgaagtacccgagaagaggcaacaagacgagccaacgccagataagcccctcgatctatctgatgccaggcgagggcagccaagctactggccgggcagccaaagagaacagagagggccacacgaagggtatagcacaagcccaactttcacaaataacttctctcctcaagccgcgaatactgatgtaaggggctcagaagagagcaggttgttggggagtctagtgaaggaagaaaacgcttgcaacgaggaggaagtcaccaaagatatgaaaaggaattcttccccttccgccgacaaagaaagagacggaatatctggcaaaagatcgacacgggggcataaaagagaaagatctctggaaacagatttggaggaagaggaggacctggagaaggacgagcagtcgccccaaatggatttcaatgagatggaaacatctgacagtgagcctgaaacagaaagcacccaccttgctctaaatgaggggcagcgggacggcttcatcaaggacaggattatccgaaaacacaaatggaccaagaaggggcatcaaggggcagtgtcaagcaaatatatgaaaaggaagaagaaagctcttctaacagagagtgacgcttcccaagaataagcctattattcataaggaagagcattaaagatacctcatgggctaaaggacagcatgaaagagaccaactgattcaagcaggaacacttaccctttatttaaggagtgggaacatataaacaggcccagaccaggccctatgtatatatgaaatactgagctcttctggtagtctctaagcctgtataaagaaattaacacagtggatgggacatccatcagtgcaaagtagaacctgaacctgaattctaatatggattaagcgtcctcacctgtaaatattcttcaatgcaattcaaagtgagactttggacaccacagcgctatagttacatttatcgactgagatccattgatggattacgtatgtaaatgtatggattctataaggaccaattagagattccaaactcatgcttccgtgtagaatcatgaattctaatattgggatgagtgtgagctaccatattgtttcccataaatagtatgaaactaccattttaaaaaaaaaaaaaaaaaa
Translation: MAAESFAEALQRLKEIHDKEVLGMQAKLSDLTMEKCRDAQRIEELFSKNHLLREQHKVLNENIKVLENRLRAGLCDRCTVTQELAKKKQQEFESSHLHSLQQISGLTNEMKSLKEENRSLLEELKKQQCLDNKHHQAFSPEIKAGPDSPRTLSASISQRNGVEKSSREEESPERASDPQVSEEKYPVAAKLSPGGKTPHILGPETHIQENHIPMAQKIYLSSLNQQKISNQLHGTIAVLRPGFRSGRAGIPSSLNKRASSNEMFPKASGVDPNDASSQLDSLKHIPEEQMCFLRQHLAQRRLGPQAPVAMGDGRCILTKGQDTEATRKVPQDDWDERVAMAELHGAMMFLRDRGFRGRVLHPDQRDRLNYILTRQHQGQRSPKSPGDVPASQRRDSIDEGELSLLHMLSARWKNKQHESQTEEKEPDMKEPKYEVPEKRQQDEPTPDKPLDLSDARRGQPSYWPGSQREQRGPHEGYSTSPTFTNNFSPQAANTDVRGSEESRLLGSLVKEENACNEEEVTKDMKRNSSPSADKERDGISGKRSTRGHKRERSLETDLEEEEDLEKDEQSPQMDFNEMETSDSEPETESTHLALNEGQRDGFIKDRIIRKHKWTKKGHQGAVSSKYMKRKKKALLTESDASQE
Donor tissue: neurula