ORFeome > MGC75938 – XORFeome 2.0

MGC75938 – XORFeome 2.0

General Information

Species: Xenopus tropicalis high-mobility group 20A, mRNA (cDNA clone MGC:75938 IMAGE:5383844), complete cds
Gene Symbol: MGC75938
Gene ID: 394538
ORF gb_acc: MG133019
ORF ID: 10407

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061376

Library Location

Plate ID: GDExt11004
Well Location: H06

EST Sequences

Clone: MGC:75938 IMAGE:5383844
Trimmed Sequence: ATGTCTCAACCAACCAAACATTTACATGGTATTTTGCACCCTGTAACAAAAACACAAGGAGGAAATTTTCTCGTGGCTGTAAAACAAGAAAAAATAGATGTCCAAAGAGCTGGCGATAAGAACACTGGGGGTGAGGAAGAGCCTGTAAAGAAACGGGGATGGCCAAAAGGAAAGAAAAGAAAAAAGATTCTGCCTAATGGCCCCAAAGCTCCAGTCACTGGTTATGTTCGTTTTTTGAATGAACGAAGAGAGCAGATAAGAGCACAGCATCCAGATCTTCCTTTCCCTGAGATTACAAAAATGCTTGGAGCCGAGTGGAGCACTCTGCCACCGCATGAGAAGCAGAGATACTTAGATGAGGCTGAGAGGGATAAGCAGCAGTATATGAAAGAGCTTCGAGAATACCAGCAGTCAGAGGCGTACAAGATGTGTGCAGAAAAGATCCAAGAGAAAAAAATTAAAAAAGAAGAGACCAGCGTAGCAGCTGCCAGTACCTTGTTAAATGGACACACACACAAAACTGGTGATTCCCAGAGTGATGGATTTTCATCTTTTGATGTGACTATATTTACAGAAGAGTTTTTGGATCAGAACAAAGTCCGTGAAGCAGAGCTTAGAAGACTGCGCAAGATGAATATGGAGTTTGAGGAACAGAATTCTATCTTACAGAGACACACAGAGAGTATGAATTGTGCCAAGGAGAGGCTGGAACAGGAACTTGCACAAGAGGAAAGGCAAACAATAGTTCTCCAGCAGCAGCTTCAAACTATCCGCCAGATTCTATTGTCTAGCTTTTCTTCCTTACCGATCCCAGGTACAGGGGAGACACCAACATTAGGAAATCTTGATGTGTACATGGCTAAACTTCACAATCTGATAGAGGGTAACCCAACTCAACATGAAAAACTAGTTATGAAGATAAAAGAAGTTTTGTCCCGGATAAACAGTGATCACCTATGA
Full Trace Sequence: ggaaagagtgaaggagcttggcgttaaaggcgctgcgggacttttaaacagcgattcgggattgcgggctctgaaaactgtgacagatcatgtctcaaccaaccaaacatttacatggtattttgcaccctgtaacaaaaacacaaggaggaaattttctcgtggctgtaaaacaagaaaaaatagatgtccaaagagctggcgataagaacactgggggtgaggaagagcctgtaaagaaacggggatggccaaaaggaaagaaaagaaaaaagattctgcctaatggccccaaagctccagtcactggttatgttcgttttttgaatgaacgaagagagcagataagagcacagcatccagatcttcctttccctgagattacaaaaatgcttggagccgagtggagcactctgccaccgcatgagaagcagagatacttagatgaggctgagagggataagcagcagtatatgaaagagcttcgagaataccagcagtcagaggcgtacaagatgtgtgcagaaaagatccaagagaaaaaaattaaaaaagaagagaccagcgtagcagctgccagtaccttgttaaatggacacacacacaaaactggtgattcccagagtgatggattttcatcttttgatgtgactatatttacagaagagtttttggatcagaacaaagtccgtgaagcagagcttagaagactgcgcaagatgaatatggagtttgaggaacagaattctatcttacagagacacacagagagtatgaattgtgccaaggagaggctggaacaggaacttgcacaagaggaaaggcaaacaatagttctccagcagcagcttcaaactatccgccagattctattgtctagcttttcttccttaccgatcccaggtacaggggagacaccaacattaggaaatcttgatgtgtacatggctaaacttcacaatctgatagagggtaacccaactcaacatgaaaaactagttatgaagataaaagaagttttgtcccggataaacagtgatcacctatgatatggaaagtggcagaagcagagaacgtgagaacctctatcagctcctcgagattttctaaaagcagaacaggaaggggtctgctatttgtgtgtaatgggtaagattgactaggatataggaaataaataaaaaaaaatgtgaaagaacatgagtacagcagaatcagtagcggactttgttatgctcaattcagatttttgttttgttaaggaattcacttgtacaattccttggtttttataccaaaaaaaaatatcaaaatgaatgccctgacacacaaactctgcttgtctaaccacacattaaacattacaacttaatctgtagctccaaatttccacttattgtaaagcttttaaaatgcataaactttgagaagttcaaatatatacctgttttaaaatcctcttgctaaagctcatagactttaaaagaagatcttaaaaagaaatgttataaaaaaaaaaaacaacttacattgtattaaaaaaaatatatatatattaatcagaataaaagagagaaaacatcttacattatacagtcacagaagacaaaatatacactactatgtttaaagcaattttctagcaaacttgattttttgggaatcaaatgtgaccataaaagcagaatgcgcaatttgtaataatgtccactttatgcagggtacttataaaattgacataatgtacataataagtaatacctgcacaaatatttgtttgttggctgtttaaaacagttttcatactagttgataactaagccataatgttatagtaataagaaatcagaactgcacttttcctttctttttttcaggataattattttattgaaatagattaatggccactttttaaagtgaattccaatttgaaacttctttgaaaaaattgtatatttatatataaaaaaaagtaacatagatcttgtagaaatgttttgtgtcttaaatataaataaatggtctaaaatgaaaatacactacaaataactggaatgtactttaattactaatggccaagtgtcaatgaacgctcttaactcattgattaattatgctcaattgtgtctctacatgtactatatctcacctatcctgaaagcagatcatgcagagtagtgataagagtcatttgttgaacacgtacaatgacacacacattaggccaggctagttttgataaaacattgcaaaatatttcactgatttgtctggattatgtgtgttgtactgccttacaatagtttgtgcataaaataaatgtttgttctggtttaaacaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSQPTKHLHGILHPVTKTQGGNFLVAVKQEKIDVQRAGDKNTGGEEEPVKKRGWPKGKKRKKILPNGPKAPVTGYVRFLNERREQIRAQHPDLPFPEITKMLGAEWSTLPPHEKQRYLDEAERDKQQYMKELREYQQSEAYKMCAEKIQEKKIKKEETSVAAASTLLNGHTHKTGDSQSDGFSSFDVTIFTEEFLDQNKVREAELRRLRKMNMEFEEQNSILQRHTESMNCAKERLEQELAQEERQTIVLQQQLQTIRQILLSSFSSLPIPGTGETPTLGNLDVYMAKLHNLIEGNPTQHEKLVMKIKEVLSRINSDHL
Donor tissue: neurula