ORFeome > MGC75976 – XORFeome 2.0

MGC75976 – XORFeome 2.0

General Information

Species: Xenopus tropicalis SH3-domain GRB2-like 1, mRNA (cDNA clone MGC:75976 IMAGE:5384280), complete cds
Gene Symbol: MGC75976
Gene ID: 394731
ORF gb_acc: MG133490
ORF ID: 11013

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061395

Library Location

Plate ID: GDExt11010
Well Location: E01

EST Sequences

Clone: MGC:75976 IMAGE:5384280
Trimmed Sequence: ATGTCTGTAGCCGGGCTTAAAAAGCAGTTTTATAAAGCAAGTCAGCTTGTGAGTGAAAAAGTTGGAGGAGCTGAAGGGACCAAATTGGATGACGAGTTTAAAGAAATGGAAAAGAAAGTTGATGTGACCACTAAAGCTGTTACTGATGTTCTTGCAAAGACTATTGAGTATCTGCAGCCAAATCCTGCTTCAAGGGCTAAGCTGTCAATGCTGAATACTATGTCTAAGATACGTGGGCAGGTGAAGAATCCAGGATATCCGCAGCCAGAAGGTGTTTTAGGAGAGACTATGATCAAATTTGGCAAAGATCTTGGGGATGAATCAAATTTTGGTGATGCTTTGCTGGATGCTGGGGAGTCAATGAAAAGGTTGGCAGAAGTAAAGGATTCTCTGGATATTGAAGTGAAACAAAACTTTTTGGATCCGCTACAGAATCTTTGTGACAAAGATTTGAAGGAGATACAGCATCATCTAAAAAAACTGGAAGGCCGGAGGTTAGATTATGACTACAAGAAGAAGCGACAAGGAAAGATACCAGATGAAGAGCTGAGACAGGCCATGGAAAAGTTCATTGAATCAAAAGAAGTGGCTGAGACGAGCATGATTAATTTGCTTGATACAGATGTTGAACAAGTTAGCCAACTGACAGCCTTGGTGGAAGCACAGCTAGACTATCACAGGCAAGCTGTGCAAATACTGGATGAACTTTCAGAAAAGCTGAAGGATCGTGTTAGAGAGTCTTCTTCAAGAACAAAACGAGAGTTCAAGCCTAAGCCACGAGAAAGCTATGAATATGCTGAAAGTGAACAGTCCAATGGTGGCTTTAGCAACCCCTCCAGCAAAGCACCAGCTTCATCATCTTTCCGCAGTGAAAAGCCTGCAAGGACTAATAACCGCAGTTCAGCTCCCTTGGACCAGCCATGTTGTAAAGCTCTTTATGACTTTGACCCTGAAAATGATGGAGAACTAGGTTTCCGTGAGAGTGATATTATTACACTTACCAATCAGATTGATGAGAACTGGTATGAAGGAATGATAAATGGCCAGTCTGGTTTTTTTCCTGTCAACTACGTTGAGATTCTGGTTCCATTGCCTCAATGA
Full Trace Sequence: gttttgtccgcgattcctgtagtcctgcaatcttagtgtaccgcaacaatgtctgtagccgggcttaaaaagcagttttataaagcaagtcagcttgtgagtgaaaaagttggaggagctgaagggaccaaattggatgacgagtttaaagaaatggaaaagaaagttgatgtgaccactaaagctgttactgatgttcttgcaaagactattgagtatctgcagccaaatcctgcttcaagggctaagctgtcaatgctgaatactatgtctaagatacgtgggcaggtgaagaatccaggatatccgcagccagaaggtgttttaggagagactatgatcaaatttggcaaagatcttggggatgaatcaaattttggtgatgctttgctggatgctggggagtcaatgaaaaggttggcagaagtaaaggattctctggatattgaagtgaaacaaaactttttggatccgctacagaatctttgtgacaaagatttgaaggagatacagcatcatctaaaaaaactggaaggccggaggttagattatgactacaagaagaagcgacaaggaaagataccagatgaagagctgagacaggccatggaaaagttcattgaatcaaaagaagtggctgagacgagcatgattaatttgcttgatacagatgttgaacaagttagccaactgacagccttggtggaagcacagctagactatcacaggcaagctgtgcaaatactggatgaactttcagaaaagctgaaggatcgtgttagagagtcttcttcaagaacaaaacgagagttcaagcctaagccacgagaaagctatgaatatgctgaaagtgaacagtccaatggtggctttagcaacccctccagcaaagcaccagcttcatcatctttccgcagtgaaaagcctgcaaggactaataaccgcagttcagctcccttggaccagccatgttgtaaagctctttatgactttgaccctgaaaatgatggagaactaggtttccgtgagagtgatattattacacttaccaatcagattgatgagaactggtatgaaggaatgataaatggccagtctggtttttttcctgtcaactacgttgagattctggttccattgcctcaatgagtttcacttggatttgcttaataaactacattaacactaaggaccaaaattatgaggaactataagcacctggcttcctgtttttgacgatctctctggaagagcaagtctttttaatcagttttataagtcagaggcctgttacttctggacgccggccatagaatacattttgtccgtccatccattgccccatttgatgcttaagatcttgcataaaggctattctagtaattcactacgtcagttactatagtgaacactaagtgccccccacatacagtttacaatatattttagtctaaccagaatgtgattttctttaaaccttttgtggtttggataaattctaaaatacttatgtatgacttctgaaaagaacccaaaccataatgcacaactgctaatggattgcattctgttgaatgggttaggcctttttcattgtctttttacaaaatactttttttcttgaatactttggctgcaagattgtggtagcaactaaggtgttaaccttttgctcctgcttattatctatgtgtatctatgtgtatgtatatgtatattatatataatctttatattctatgtgacatcatgtatcttggtacagttatctattttagcctagggattaacattgtgaatatacagagaccattggatctgctaggtttacttctgtatctctttaatggaccaataataccaaacaaaatgaaaattaatcatttaaatatacataccattttctttactgaacatgtaacagtatttctccttaagtgaaagtcatggctgtaggtatttttacatactgcgtaaatccgttcagcatattgaaaaaaaaaaaaaaaaaaaaa
Translation: MSVAGLKKQFYKASQLVSEKVGGAEGTKLDDEFKEMEKKVDVTTKAVTDVLAKTIEYLQPNPASRAKLSMLNTMSKIRGQVKNPGYPQPEGVLGETMIKFGKDLGDESNFGDALLDAGESMKRLAEVKDSLDIEVKQNFLDPLQNLCDKDLKEIQHHLKKLEGRRLDYDYKKKRQGKIPDEELRQAMEKFIESKEVAETSMINLLDTDVEQVSQLTALVEAQLDYHRQAVQILDELSEKLKDRVRESSSRTKREFKPKPRESYEYAESEQSNGGFSNPSSKAPASSSFRSEKPARTNNRSSAPLDQPCCKALYDFDPENDGELGFRESDIITLTNQIDENWYEGMINGQSGFFPVNYVEILVPLPQ
Donor tissue: neurula