ORFeome > MGC76024 – XORFeome 2.0

MGC76024 – XORFeome 2.0

General Information

Species: Xenopus tropicalis serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2, mRNA (cDNA clone MGC:76024 IMAGE:5384821), complete cds
Gene Symbol: MGC76024
Gene ID: 394528
ORF gb_acc: MG133522
ORF ID: 11047

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061423

Library Location

Plate ID: GDExt11010
Well Location: D10

EST Sequences

Clone: MGC:76024 IMAGE:5384821
Trimmed Sequence: ATGAGGAGTTTATTCACCCTCCTATTTCTTGGTGCTTTTCTGGCATCTGCACAACCAGAGCTCGATCTACTATCCCTGGAGGAACTGGGCTCAGACATTGGAATTCAAGTCTTTAACCAAGTGGTTAAGAGCAGGCCGCATGAAAATTTTGTAATGTCACCACATGGAATCTCATCTGTGCTGGGCATGCTGCAGCTTGGGGCAGATGGGAAGACTAAGAAGCAATTGATGACTGTCATGCGGTATAAAATCAATGAGGTTGCCAAAAGCCTAAAGAAAATTAACCGGGCCATCGTTGCAAAGAAGAATAAAGATATTGTGACGAGTGCAAATGGAGTGTTTGCCAGCAGTGTGTTCAAAATGGAGAGCTCCTTTGTCTACAAGAATAAAGATGTCTTTCACAGTGATGTCAGAAGTGTTGACTTTCAGGAGAAGAACACAGCTGCTTCCATTATTAACCAGTGGGTGAAAAATCAGACTAATGGGATGATAGAAGGACTGATCTCACCAGAACTATTGGACAGTTCTGTTACACGGCTGGTACTGGTTAATGCTCTGTATTTCAAGGGACTCTGGAAATCTCGCTTCCAGCCAGAAAACACAAAGAAACGCACCTTTCATGGACCAGACGGAAAAGACTATCAAGTGCCTATGTTAGCCCAGCTGTCGCTGTTCAGAAGTGGCTCTGCAAGTACACCCAATGGTCTTTGGTACAATGTCATCGAACTTCCTTACCATGGAGGAAGCCTTAGCATGCTAGTGGCATTGCCCACAGAAGAGAGCACGCCTTTGTCTGCCATCATCCCCCACATTAGTACCAAAACCCTGCAGAGCTGGATGACTATGACTCCAAAGAGAGTTCAGCTCATCTTACCAAAGTTCAGTGTGGAAGCCGAAGCTGATCCAAAAAGAGCCTCTAAGGAACTTGGGTATCACAGAGATGTTTGA
Full Trace Sequence: ggcagctgtcactgagggaaggtggggactggggatgggggcgggcaaacagagacagcatctgtgaataaacagtgtgggaggagggaaaggggctgtcttccttgtgagactgagtaatgagccgagacccatcagttttgctatagagctaaaggcggagcagggagagaaaggatctgtgctgctcctgtgagtattctttctccgcttctgccgagctgtagaatcatcatgaggagtttattcaccctcctatttcttggtgcttttctggcatctgcacaaccagagctcgatctactatccctggaggaactgggctcagacattggaattcaagtctttaaccaagtggttaagagcaggccgcatgaaaattttgtaatgtcaccacatggaatctcatctgtgctgggcatgctgcagcttggggcagatgggaagactaagaagcaattgatgactgtcatgcggtataaaatcaatgaggttgccaaaagcctaaagaaaattaaccgggccatcgttgcaaagaagaataaagatattgtgacgagtgcaaatggagtgtttgccagcagtgtgttcaaaatggagagctcctttgtctacaagaataaagatgtctttcacagtgatgtcagaagtgttgactttcaggagaagaacacagctgcttccattattaaccagtgggtgaaaaatcagactaatgggatgatagaaggactgatctcaccagaactattggacagttctgttacacggctggtactggttaatgctctgtatttcaagggactctggaaatctcgcttccagccagaaaacacaaagaaacgcacctttcatggaccagacggaaaagactatcaagtgcctatgttagcccagctgtcgctgttcagaagtggctctgcaagtacacccaatggtctttggtacaatgtcatcgaacttccttaccatggaggaagccttagcatgctagtggcattgcccacagaagagagcacgcctttgtctgccatcatcccccacattagtaccaaaaccctgcagagctggatgactatgactccaaagagagttcagctcatcttaccaaagttcagtgtggaagccgaagctgatccaaaaagagcctctaaggaacttgggtatcacagagatgtttgatgtatcaaaagccaactttgcaaagatcacaagatcagagagtctccacgtctcgcacctgctccagaaagctaagatagaagtaaatgaggatggtacaaaggcatctggagccacaactgcagttttgatagcaagatcatcgccccgttggtttacagtggacaggccatttttgttttttatccgacataatcctacaggtgctgtgctcttcacagggcagattaataagccttgaggggaaggcgttcctgcatcctgattccagtgctagatatttgtacattgccctgtttttttgtgaactcttatcattttttaaacagaacgtttcactgtatttgtaatggttttcgttaactttgttttgataacgcagattgacggcacacttgctaagggggttatttttaactactgagtgtttgtggctttgttaggtttttttatccaatttttttttgtttccacattttaatatatgtaattattcccagaatttctcgttattttgaaagccagttgtatattaaagtggtgtaacccgtaggccagctgcttctgtggtaggggatgttttggctgagtggagagtattactgctttagtctccatactttcactgaacgtagaaatcttgcaggtgctgggacgcattttcagcaaagagaaatttgtgccccagtgcatttatcaatatcagccaatcagacactgttttattgtctgacttacagcaaactccattcagtttgctgtctggttgctgtagggcaaacttgcagcgatgtcacccgatccttcgtttagggttttcttataaaaatgacaaattcttgcagaaccattgtccgttgacataaatcaatgagaattctataagattttatttcctgctaaccatgccccagagtagagtagaatatttggcctatttatttcagatacaaaggatgttcttccacatcaaatccactaggagcaatactgttcctttacagcaggggtgttcagctgacagccagaacagctacaggagggctatgtctgctataatgcaccccatccccgccactgattggctaaaatattgatttcctctgtgtatcgagtattttccagtctgcagtaaaggttacacccaaagccattttaattccctttggagttgctggccttgtttaacattgattaagatgaaagtgtccagtttttatattgtgtgtaacaccatgcatgtgttcattgaaataaactaaattaacatttgtatggcaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MRSLFTLLFLGAFLASAQPELDLLSLEELGSDIGIQVFNQVVKSRPHENFVMSPHGISSVLGMLQLGADGKTKKQLMTVMRYKINEVAKSLKKINRAIVAKKNKDIVTSANGVFASSVFKMESSFVYKNKDVFHSDVRSVDFQEKNTAASIINQWVKNQTNGMIEGLISPELLDSSVTRLVLVNALYFKGLWKSRFQPENTKKRTFHGPDGKDYQVPMLAQLSLFRSGSASTPNGLWYNVIELPYHGGSLSMLVALPTEESTPLSAIIPHISTKTLQSWMTMTPKRVQLILPKFSVEAEADPKRASKELGYHRDV
Donor tissue: gastrula