ORFeome > MGC76092 – XORFeome 2.0

MGC76092 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76092, mRNA (cDNA clone MGC:76092 IMAGE:5308229), complete cds
Gene Symbol: MGC76092
Gene ID: 394917
ORF gb_acc: MG132760
ORF ID: 10064

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064203

Library Location

Plate ID: GDExt11001
Well Location: B08

EST Sequences

Clone: MGC:76092 IMAGE:5308229
Trimmed Sequence: ATGAGCAGTATCGAGGCGGTGAAACGTAAGATCCAGGTGCTGCAGCAGCAGGCGGATGAGGCGGAGGAGAAATCCGAGCGGCTCTGCCGGGATCTGGAGGGAGAGAAACGGGCCCGGGAGACGGCTGAAGCCGAGGTTGCCTCTCTGAACCGCCGTATCCAGTTAGTAGAGGAAGAACTGGACCGGGCCCAAGAGCGCCTCTCTACTGCACTACAGAAACTGGAGGAGGCAGAGAAGACGGCTGATGAAAGCGAGAGGGGGATGAAGGTGATTGAAAACAGAGCCCTGAAAGATGAGGAGAAAATGGAGCTGCAGGAAATCCAGCTGAAAGAAGCCAAACATATAGCAGAAGAAGCAGACAGGAAATATGAGGAGGTGGCCCGGAAGCTGGTCATTATCGAGGGGGACCTCGAACGCACGGAGGAGCGGGCAGAACTGGCCGAGTCCCGATGCCGAGACCTGGAGGAGCAGATCCGCATGTTGGACCACAGCCTGAAGTGCCTGAATGCCACAGAGGAAAAGTACTCCAAAAAGGAAGATAAATATGAGGAGGAAATCAAGATTCTGACTGACAAGCTCAAAGAGGCTGAGACCAGAGCGGAGTTTGCCGAGCGGTCCGTGGCCAAGCTTGAGAAGACCATCGATGATTTGGAAGATAAGCTGCGACTCACCAAGGACGAGAACGCTAAGATGCAGACGATGTTGGACGACACCCTGCAGCAACTCAACAGCTTGTAG
Full Trace Sequence: gcggaagggagtcagtcagtctctgagagagagagagagagagggaaatgtcgggcggagggatgagcagtatcgaggcggtgaaacgtaagatccaggtgctgcagcagcaggcggatgaggcggaggagaaatccgagcggctctgccgggatctggagggagagaaacgggcccgggagacggctgaagccgaggttgcctctctgaaccgccgtatccagttagtagaggaagaactggaccgggcccaagagcgcctctctactgcactacagaaactggaggaggcagagaagacggctgatgaaagcgagagggggatgaaggtgattgaaaacagagccctgaaagatgaggagaaaatggagctgcaggaaatccagctgaaagaagccaaacatatagcagaagaagcagacaggaaatatgaggaggtggcccggaagctggtcattatcgagggggacctcgaacgcacggaggagcgggcagaactggccgagtcccgatgccgagacctggaggagcagatccgcatgttggaccacagcctgaagtgcctgaatgccacagaggaaaagtactccaaaaaggaagataaatatgaggaggaaatcaagattctgactgacaagctcaaagaggctgagaccagagcggagtttgccgagcggtccgtggccaagcttgagaagaccatcgatgatttggaagataagctgcgactcaccaaggacgagaacgctaagatgcagacgatgttggacgacaccctgcagcaactcaacagcttgtagatatagggccggggagccccgcctcctcctgccgccacattcctcccgcctctcctccccccgcccacttcctccgactgggatcagtcgccgactgccttggcccctcccacgggcgttttttcttattgtgtgaactctttgcaaatgaccaattgtgtgagattttctatgccccgcccccccaaactgaagtcacccgagggagtgtccgctttttatggaccaaattgtgctgctgtattggcatctccatgggtgctcaccggtgccatatgtgaggatagggtctctattcccgttaacgtaggttttacccataatgcctagccggccccgttccttcccccgacacaagagactgccgtaaggctggtttggctcctcctcctccttctacctgtacctttcccgctcagtactggtcctctacctgttgcccccgccgtacatgggttggcataagcagctgactccgcccctccagaccgagtcagcagcttattggcccacgtatggcgccttccatatgccccatctggcgtatatctgtggggcaggttagagaatgacattgggtggggaccacatagatacagaccaatgactaagggtgggaatgtatttgcccctcaccctactgggtgaacgtatcactgccgccatcttgtctcctttatacacgtgtccgttctgcttactgtattggcgtgggggggagaggggggcttactgggatctgctttggtgcaattagaacaaataaaaattcatgtgccacttttcaaaaaaaaaaaaaaaaaaaaaaagaaaaaaaaaaaaaaaaaaaaaa
Translation: MSSIEAVKRKIQVLQQQADEAEEKSERLCRDLEGEKRARETAEAEVASLNRRIQLVEEELDRAQERLSTALQKLEEAEKTADESERGMKVIENRALKDEEKMELQEIQLKEAKHIAEEADRKYEEVARKLVIIEGDLERTEERAELAESRCRDLEEQIRMLDHSLKCLNATEEKYSKKEDKYEEEIKILTDKLKEAETRAEFAERSVAKLEKTIDDLEDKLRLTKDENAKMQTMLDDTLQQLNSL
Donor tissue: gastrula