ORFeome > MGC76132 – XORFeome 2.0

MGC76132 – XORFeome 2.0

General Information

Species: Xenopus tropicalis Ferritin, lower subunit (Ferritin L), mRNA (cDNA clone MGC:76132 IMAGE:5309281), complete cds
Gene Symbol: MGC76132
Gene ID: 394709
ORF gb_acc: MG132702
ORF ID: 9993

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC062508

Library Location

Plate ID: GDExt11001
Well Location: D08

EST Sequences

Clone: MGC:76132 IMAGE:5309281
Trimmed Sequence: ATGGAGTCTCAGGTCCGGCACAATTTCCACCAGGACTGCGAGGCCGGGCTCAATCGCTTGGTGAACCTGAAATACCACAGCTCCTATGTGTACCTGTCCCTGTCCTCCTATTTTGACCGTGATGATGTCGCCCTGGCCAACTTCGCCAAATTCTTCCGGGAACGTTCGGAAGAGGAAAGGGAGCACGCAGAGAAATTTATCAAGTACCAGAATGAGAGGGGCGGGCGGCTCTACCTGCAGAATGTAGAAAAACCAGAGCGAGATGACTGGACCAGTGGCTTGGAGGCACTCCAGGTAGCGCTGAAACTGGAGAAGCATGTCAATCAAGCACTGTTGGATCTGCACGGTGTCGCTGGAAGCAAGAATGACCCTCATATGTGCGATTTCCTGGAATCTCCATTTCTATCAGAGAGCACTGAAGTGATCAAGAAGCTTGGAGACCACACCACCAGCCTGAGGAAGCTCAGTGGGGGCCAGCCTGGAATGGGGGAGTATCTCTTTGATAAGCACACGCTCGGTTGA
Full Trace Sequence: gtttccacaacagaggttgcaatggagtctcaggtccggcacaatttccaccaggactgcgaggccgggctcaatcgcttggtgaacctgaaataccacagctcctatgtgtacctgtccctgtcctcctattttgaccgtgatgatgtcgccctggccaacttcgccaaattcttccgggaacgttcggaagaggaaagggagcacgcagagaaatttatcaagtaccagaatgagaggggcgggcggctctacctgcagaatgtagaaaaaccagagcgagatgactggaccagtggcttggaggcactccaggtagcgctgaaactggagaagcatgtcaatcaagcactgttggatctgcacggtgtcgctggaagcaagaatgaccctcatatgtgcgatttcctggaatctccatttctatcagagagcactgaagtgatcaagaagcttggagaccacaccaccagcctgaggaagctcagtgggggccagcctggaatgggggagtatctctttgataagcacacgctcggttgaatgctgcattgctggaaacctctacctcatcctgtgtaggagctaatccaactggagacacacacaagctgtttttttaaaaataacaaccattccaaatttctaggagattgaaaaagtttatccttttcaaataaaatgtgccatgtgacatgtcaaaaaaaaaaaaaaaaaaa
Translation: MESQVRHNFHQDCEAGLNRLVNLKYHSSYVYLSLSSYFDRDDVALANFAKFFRERSEEEREHAEKFIKYQNERGGRLYLQNVEKPERDDWTSGLEALQVALKLEKHVNQALLDLHGVAGSKNDPHMCDFLESPFLSESTEVIKKLGDHTTSLRKLSGGQPGMGEYLFDKHTLG
Donor tissue: gastrula