ORFeome > MGC76170 – XORFeome 2.0

MGC76170 – XORFeome 2.0

General Information

Species: Xenopus tropicalis adenylate kinase-like protein C9orf98 homolog-like, mRNA (cDNA clone MGC:76170 IMAGE:5335533), complete cds
Gene Symbol: MGC76170
Gene ID: 394708
ORF gb_acc: MG132724
ORF ID: 10021

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC062516

Library Location

Plate ID: GDExt11001
Well Location: E01

EST Sequences

Clone: MGC:76170 IMAGE:5335533
Trimmed Sequence: ATGGACGCTACAAGGAAACCCCTGCGAATCCCGCCGGCTATGGCACTGTATGCGGAGGAGCAGGGAGTGTTTGATATTATTCAGAAAATGGTGAAGAAGGTTCTAGTGGACAGACCCAAAGACCCAATCCAGTACATGATTGATCATCTCTCCAATGATAATGATGATGTACCTAGAGTTTTCATTCTGGGCCCTCCTGCATCCGGAAAGCACACTATGGCGAAGCTGCTATGTAAGCGTCTGAATGCCACTCACCTCACTCCTGAGAGCGTCTTGTCAAGTGATGTGTCTTTGCTGGCGAAGGAAGCACAGTCATACAGAGATAAAGGCCAGGAAGTCCCAGATGAGCTGTGGGCCAAGCTGATGCAACAGCGACTGTCAAAAGTGGACTGCATTAAACGAGGATGGATTTTGGAAGGGTTCCCCAAAACACGAGAGCAAGCGCTAAAGCTGCAGATGGCTGGAATATGCCCTGACCATTTAGTTGTGCTGGATGCTCCAGATATTGTCCTGATTGAGAGAAATATGGGGAAAAGGATTGATACTGCAAATGGAGAGGTCTATCACACCACCTTCGACTGGCCCAGTGACCCCACAGTGCAGAGGAACTTGGTGGAACCAGAGGGAATCTCTGAGGAGGAAACTGGACTACGGCTCATAGAGTACCACAGAAATATCCCAGGCATATTGCGCACTTACCCAAAGACGTCCAAGAAGATAAACGCAGACCAGCCATACATGGATGTCTTCTCACAAGTGCTGACGTTTGTTTTAAGCAAGCCAAGGTCCTTGGCACCTCACACACCTCGAATACTCCTGTACGGGCCCCCGGGCAGTGGGCGGAGCCTCCAGGCGTCGTTGCTGGCGCAGAAGTATGGCATTGTCAACATTTGCTGTGGCCAAGTGCTGAAAGAAGCGGTTGCTGACCAAACGAAACTTGGAGAGGTCATCCAGCCTTACATTGAGAATGACCAGCAAGTGCCAGATAACCTTGTCTTGAAGATCTTAACAGAACACCTTAGTAGTCTGGAGTCTGCTACACACGGCTGGGTTCTACATGGATTCCCACGAGACACTGACCAGGCTGCTCTGCTGAAAGATGCAGGGTTTGTGCCCAACAGGGTCTTCTCTCTGGATCTCTCAGACGATGTTGTCATAGAGCGTCTGTCTTTGTGCATGACAGATCCCGTCTCAGGAGAGAGGTACCACGACATATACAAGCCCGCGCCCAGTTCGGAGGTACACGAGCGCCTGCAGCAGAACCCCAGGCATTCGGAGCAGAGGGTTCAGGCGAGGCTAGACATGTACCACGCTAACGCCGAGGAGCTGGACGAGTTTTATCCGGATGTCATTCACATTAATGCTGATCAAGACCCTTACACGGTGTTTGAGTTCATCGAAAGCTACACTGTCAGCCCCCTGCCCAGGCCTCTCCCCGAGGAGCCCACATCTCCCTAA
Full Trace Sequence: cagagatggacgctacaaggaaacccctgcgaatcccgccggctatggcactgtatgcggaggagcagggagtgtttgatattattcagaaaatggtgaagaaggttctagtggacagacccaaagacccaatccagtacatgattgatcatctctccaatgataatgatgatgtacctagagttttcattctgggccctcctgcatccggaaagcacactatggcgaagctgctatgtaagcgtctgaatgccactcacctcactcctgagagcgtcttgtcaagtgatgtgtctttgctggcgaaggaagcacagtcatacagagataaaggccaggaagtcccagatgagctgtgggccaagctgatgcaacagcgactgtcaaaagtggactgcattaaacgaggatggattttggaagggttccccaaaacacgagagcaagcgctaaagctgcagatggctggaatatgccctgaccatttagttgtgctggatgctccagatattgtcctgattgagagaaatatggggaaaaggattgatactgcaaatggagaggtctatcacaccaccttcgactggcccagtgaccccacagtgcagaggaacttggtggaaccagagggaatctctgaggaggaaactggactacggctcatagagtaccacagaaatatcccaggcatattgcgcacttacccaaagacgtccaagaagataaacgcagaccagccatacatggatgtcttctcacaagtgctgacgtttgttttaagcaagccaaggtccttggcacctcacacacctcgaatactcctgtacgggcccccgggcagtgggcggagcctccaggcgtcgttgctggcgcagaagtatggcattgtcaacatttgctgtggccaagtgctgaaagaagcggttgctgaccaaacgaaacttggagaggtcatccagccttacattgagaatgaccagcaagtgccagataaccttgtcttgaagatcttaacagaacaccttagtagtctggagtctgctacacacggctgggttctacatggattcccacgagacactgaccaggctgctctgctgaaagatgcagggtttgtgcccaacagggtcttctctctggatctctcagacgatgttgtcatagagcgtctgtctttgtgcatgacagatcccgtctcaggagagaggtaccacgacatatacaagcccgcgcccagttcggaggtacacgagcgcctgcagcagaaccccaggcattcggagcagagggttcaggcgaggctagacatgtaccacgctaacgccgaggagctggacgagttttatccggatgtcattcacattaatgctgatcaagacccttacacggtgtttgagttcatcgaaagctacactgtcagccccctgcccaggcctctccccgaggagcccacatctccctaatgacttgcagcgtatgcactgttagtctggattaactggcggcatcacaggaaggcgacactgagcccttcccctcctgttagtcccttcccgatgtcccccctacctcccagaatggaatattcccgctcagttggcttcctgccaaaataaatacaccaacagttcattatcccaaggtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDATRKPLRIPPAMALYAEEQGVFDIIQKMVKKVLVDRPKDPIQYMIDHLSNDNDDVPRVFILGPPASGKHTMAKLLCKRLNATHLTPESVLSSDVSLLAKEAQSYRDKGQEVPDELWAKLMQQRLSKVDCIKRGWILEGFPKTREQALKLQMAGICPDHLVVLDAPDIVLIERNMGKRIDTANGEVYHTTFDWPSDPTVQRNLVEPEGISEEETGLRLIEYHRNIPGILRTYPKTSKKINADQPYMDVFSQVLTFVLSKPRSLAPHTPRILLYGPPGSGRSLQASLLAQKYGIVNICCGQVLKEAVADQTKLGEVIQPYIENDQQVPDNLVLKILTEHLSSLESATHGWVLHGFPRDTDQAALLKDAGFVPNRVFSLDLSDDVVIERLSLCMTDPVSGERYHDIYKPAPSSEVHERLQQNPRHSEQRVQARLDMYHANAEELDEFYPDVIHINADQDPYTVFEFIESYTVSPLPRPLPEEPTSP
Donor tissue: tailbud