ORFeome > MGC76184 – XORFeome 2.0

MGC76184 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76184, mRNA (cDNA clone MGC:76184 IMAGE:5335794), complete cds
Gene Symbol: MGC76184
Gene ID: 394800
ORF gb_acc: MG132685
ORF ID: 9975

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063215

Library Location

Plate ID: GDExt11001
Well Location: G02

EST Sequences

Clone: MGC:76184 IMAGE:5335794
Trimmed Sequence: ATGACGAGCTCAGGAAAAGAGAACTCTCGGCTGAAGAGCTACAAGAACAAGTCTCTAAACACGGACGAGATGCGGCGAAGGAGGGAAGAGGAGGGACTGCAGCTGCGCAAACAGAAACGAGAAGAGCAGCTCTTTAAGCGCAGAAATGTCGCCTGCGCTGAGGAAGCGACAGAAGAGGAGGGAATGTCCGATGGCAACTTCCACGAGGCACAGATCAACAATATGGAAATGGCTTCCAGTGGGGTTATTACGGGAGACATGATAGAGATGATTTTCTCCAACAACCCAGAGCAGCAGCTTGCAGCGACGCAGAAGTTCAGAAAACTGCTATCAAAAGAGCCCAACCCTCCCATTGATGAGGTTATAGGGACTCCGGGGGTGGTCGCTAGATTCGTGGAATTCCTGAAGCGGAAAGAGAACTGTACATTACAGTTTGAAGCAGCGTGGGTGCTCACTAACATTGCCTCCGGGAACTCCGTACAGACCCGCATTGTCATCCAGGCAGGAGCGGTGCCCATCTTTATAGAGCTGCTCAGCTCAGAGTTCGAAGACGTTCAGGAGCAGGCAGTCTGGGCTCTAGGGAACATTGCCGGAGACAGCACCGTGTGTCGGGATTATGTGTTGGACTGCAATATTCTGCCTCCGCTTTTACAATTACTGTCCAAGCAGAACCGTCTTACAATGACTCGAAATGCAGTGTGGGCACTGTCTAACCTTTGTAGAGGGAAGAATCCACCCCCTGAATTCGCCAAGGTTTCCCCATGCCTCACTGTCCTGTCCTGGCTTCTCTTTGTCAACGACACTGATGTACTTGCCGATGCCTGCTGGGCGCTGTCCTATCTGTCAGATGGGCCGAACGATAAGATCCAGGCCGTGATCGATGCAGGCGTGTGTAGAAGATTAGTGGAACTACTAATGCACAATGATTACAAAGTGGTGTCTCCTGCCCTGCGGGCTGTTGGCAACATAGTGACTGGGGATGACATCCAGACACAAGTGATTCTAAACTGCTCGGCCCTACAGAGTTTGCTGCATCTGTTGAGTAGCCCCAAGGAATCTATAAAGAAGGAGGCATGTTGGACGATATCAAACATCACAGCCGGGAACAGAGTTCAGATACAGACAGTGATTGAGGCCAACATCTTTCCAGCTCTGATAAACATTCTGCAGACGGCAGAATTCAGGACAAGAAAAGAGGCTGCGTGGGCTATCACAAACGCAACATCCGGGGGCTCCGCAGAACAGATCAGGTACCTGGTTGATTTAGGTTGCATCAAACCTCTTTGTGACCTCCTGACTTGCATGGATTCCAAGATCGTACAGGTGGCCCTGAATGGCTTAGAAAACATACTGAGGCTGGGCGAGCAAGAGGCAAAGCGGAACGGGACAGGCATTAACCCTTACTGCGCTCTTATTGAAGAAGCATATGGACTGGACAAGATCGAGTTCCTACAGAGCCATGAAAACCAGGAGATCTACCAGAAGGCGTTCGACCTGATCGAGCACTACTTCGGCACCGAGGACGAGGACAGCAGCATTGCCCCCCAGGTGGACCTCAGCCAGCAGCAGTTCATCTTCCAGCAACGAGAAGCTCCCATGGAGGGTTTCCAGCTCTAA
Full Trace Sequence: caaataccggctgctgtggcgagaggccgaaacctgggaacggcggcggagtgacagtgggagcgccgacacagaacggaacacggtccccttgggcttattcagtaccgaccaacgtgtggaggccgagcaagaaatcatgacgagctcaggaaaagagaactctcggctgaagagctacaagaacaagtctctaaacacggacgagatgcggcgaaggagggaagaggagggactgcagctgcgcaaacagaaacgagaagagcagctctttaagcgcagaaatgtcgcctgcgctgaggaagcgacagaagaggagggaatgtccgatggcaacttccacgaggcacagatcaacaatatggaaatggcttccagtggggttattacgggagacatgatagagatgattttctccaacaacccagagcagcagcttgcagcgacgcagaagttcagaaaactgctatcaaaagagcccaaccctcccattgatgaggttatagggactccgggggtggtcgctagattcgtggaattcctgaagcggaaagagaactgtacattacagtttgaagcagcgtgggtgctcactaacattgcctccgggaactccgtacagacccgcattgtcatccaggcaggagcggtgcccatctttatagagctgctcagctcagagttcgaagacgttcaggagcaggcagtctgggctctagggaacattgccggagacagcaccgtgtgtcgggattatgtgttggactgcaatattctgcctccgcttttacaattactgtccaagcagaaccgtcttacaatgactcgaaatgcagtgtgggcactgtctaacctttgtagagggaagaatccaccccctgaattcgccaaggtttccccatgcctcactgtcctgtcctggcttctctttgtcaacgacactgatgtacttgccgatgcctgctgggcgctgtcctatctgtcagatgggccgaacgataagatccaggccgtgatcgatgcaggcgtgtgtagaagattagtggaactactaatgcacaatgattacaaagtggtgtctcctgccctgcgggctgttggcaacatagtgactggggatgacatccagacacaagtgattctaaactgctcggccctacagagtttgctgcatctgttgagtagccccaaggaatctataaagaaggaggcatgttggacgatatcaaacatcacagccgggaacagagttcagatacagacagtgattgaggccaacatctttccagctctgataaacattctgcagacggcagaattcaggacaagaaaagaggctgcgtgggctatcacaaacgcaacatccgggggctccgcagaacagatcaggtacctggttgatttaggttgcatcaaacctctttgtgacctcctgacttgcatggattccaagatcgtacaggtggccctgaatggcttagaaaacatactgaggctgggcgagcaagaggcaaagcggaacgggacaggcattaacccttactgcgctcttattgaagaagcatatggactggacaagatcgagttcctacagagccatgaaaaccaggagatctaccagaaggcgttcgacctgatcgagcactacttcggcaccgaggacgaggacagcagcattgccccccaggtggacctcagccagcagcagttcatcttccagcaacgagaagctcccatggagggtttccagctctaaccccccccccccccccccgcgctgggctccgcgtgctgcagtgcgagtgccccccagagcgctcactcactgtttgctgtgttcaagctctcgctcactcccgccccccctacacttctctatttattcagccaccttttatttccccctctccttctctttctgcctctttttttcttgcttccacctagtttttattttttctctttctcccccccccccccccccctcgttgctacgtgacagacccagccggatgctgtcagcggattgggactgcttgccctggtcctagaggttccacgccgtgcctcattcagcaccactacagttctggtgtcggccctcctgctgtgcttttgacatatcttcatttcatatgactcgagtattagaagtatacaggaactccacgggcagagccgcgtccgcggagaaggacggaaacgaaatggacgagacgttaatactgacacgagaatatcactgtcccgaggccactacgacgcgcgactgtaccgctcgatatctgcttcatgggaaactacaagccaaactgggagagagctttgttccagcctgggaaccggcattaatatttagctataaaaccgcaaatcccaaacacgaaaactacaggtgtgatactaataagctaactggccccgctgcacctcaagccttccatgggccaatccaattgctgaatactgaccatctcattgccaggaaaggagtgtccagctatgccgacgccccttccgggctgcctttttattttattttttttttaatgttatttttaaattcacgaccttggtgtctctccgctctcggaccccaagagacgtcggaccgccactgctcggctgtaccttcaatcacagagacttgcgacggacaggtcaggacttttctagtgactctttcaattaaaaaaaaaaaaaaa
Translation: MTSSGKENSRLKSYKNKSLNTDEMRRRREEEGLQLRKQKREEQLFKRRNVACAEEATEEEGMSDGNFHEAQINNMEMASSGVITGDMIEMIFSNNPEQQLAATQKFRKLLSKEPNPPIDEVIGTPGVVARFVEFLKRKENCTLQFEAAWVLTNIASGNSVQTRIVIQAGAVPIFIELLSSEFEDVQEQAVWALGNIAGDSTVCRDYVLDCNILPPLLQLLSKQNRLTMTRNAVWALSNLCRGKNPPPEFAKVSPCLTVLSWLLFVNDTDVLADACWALSYLSDGPNDKIQAVIDAGVCRRLVELLMHNDYKVVSPALRAVGNIVTGDDIQTQVILNCSALQSLLHLLSSPKESIKKEACWTISNITAGNRVQIQTVIEANIFPALINILQTAEFRTRKEAAWAITNATSGGSAEQIRYLVDLGCIKPLCDLLTCMDSKIVQVALNGLENILRLGEQEAKRNGTGINPYCALIEEAYGLDKIEFLQSHENQEIYQKAFDLIEHYFGTEDEDSSIAPQVDLSQQQFIFQQREAPMEGFQL
Donor tissue: tailbud