ORFeome > MGC76235 – XORFeome 2.0

MGC76235 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76235, mRNA (cDNA clone MGC:89176 IMAGE:7016530), complete cds
Gene Symbol: MGC76235
Gene ID: 394516
ORF gb_acc: MG134214
ORF ID: 11867

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075420

Library Location

Plate ID: GDExt11018
Well Location: H07

EST Sequences

Clone: MGC:89176 IMAGE:7016530
Trimmed Sequence: ATGTCCAGCCTGCAGAGATCGGCCCCTGCCTCACAGAATGTGTCCCTGCCTCTGGAGCAGGTTAAGGAGGCTCTAGGGGAAGTGCTGAACGCTCTGCAGTCGCCTACGGGAAGTGCCCGGCTGGAAGAGGCAAGAGAGAATTCCGGGAATGACCTCGGGAAAGTCCTGCAGCTTCTTCTCCCGGCAGCTGTTCAGATCCAGCAGGAAGTTCTGCAGAATTACGGATTTAGTCCTGATGGTGAGGGTGTCCTCAGATTTGCCAGACTTGTCAAGTCTTATGAATCACAGGACCCTGAAATTGCCGCTATGTCCAGCAAACTGAAGTCCTTCTTCCTGCCGCCGTTACCGCTTCCCCCCCACGCTGGTCTCTCCGCCCCTTCATCATGA
Full Trace Sequence: gtcaggcgctgtgagaagggactgcgttacccataatgcacagaggagtccctttgtagcagctcggagcgggtatagacatgtccagcctgcagagatcggcccctgcctcacagaatgtgtccctgcctctggagcaggttaaggaggctctaggggaagtgctgaacgctctgcagtcgcctacgggaagtgcccggctggaagaggcaagagagaattccgggaatgacctcgggaaagtcctgcagcttcttctcccggcagctgttcagatccagcaggaagttctgcagaattacggatttagtcctgatggtgagggtgtcctcagatttgccagacttgtcaagtcttatgaatcacaggaccctgaaattgccgctatgtccagcaaactgaagtccttcttcctgccgccgttaccgcttcccccccacgctggtctctccgccccttcatcatgaactgttccacttcttgttgcgaaatagcaggctatgcctgaaacatccatcactcctccctttggctgttacacacttggcccctcattaatggacagtcggggggggggggggcatgggattaaggaatctttttctgtctgttactttaacatttcaggctccagttctccctcagagggaatcattttgtcccactctgtctggtatcggtggtactttctgcggtggcatatgagatacataacaagttagttatactagaaaatactcagagggaggatgggcctgtattgatctgtctcttgtattgctctgtatagaggggagtttgtgaaaaatagaggcagaaaacatttttggccccagaccttaagccaggactgtctggaagcccaagttttagatgtggccctcagagtaatggctatagcccccagcctggccattggctagataaacttatttctatgacataatcagggctaagaacatttggcatattaaatatgcaggcagggtgctgtcttctctaggaagttttcctcccaaagtttatcattctaaccaggggttagaaaaggtccaaaatggagcctgtgccagatacagtacagtcagtaagctttgttgtgggatggttgaaaacagtggcataactatggttctttggtctctagttacaccactggctaaaaaaaatgaaagtaatttgaaataaacaaaactgtatcagcttctgcttaaaaaaaaaaaaaaaaaaaaaaaagaaaaa
Translation: MSSLQRSAPASQNVSLPLEQVKEALGEVLNALQSPTGSARLEEARENSGNDLGKVLQLLLPAAVQIQQEVLQNYGFSPDGEGVLRFARLVKSYESQDPEIAAMSSKLKSFFLPPLPLPPHAGLSAPSS
Donor tissue: