ORFeome > MGC76292 – XORFeome 2.0

MGC76292 – XORFeome 2.0

General Information

Species: Xenopus tropicalis transketolase, mRNA (cDNA clone MGC:76292 IMAGE:5379520), complete cds
Gene Symbol: MGC76292
Gene ID: 394835
ORF gb_acc: MG132872
ORF ID: 10232

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063226

Library Location

Plate ID: GDExt11003
Well Location: F01

EST Sequences

Clone: MGC:76292 IMAGE:5379520
Trimmed Sequence: ATGGACACTTACCAGAAACCAGAAGATAAGGAGCTGCAGGCCCTCAAGGATGCGGCCAACCGGCTGCGGATCCATTCCATTAGGGCAACATGCGCCTCCAACTCAGGGCATCCCACCTCCTGCTGCAGTGCTGCTGAAGTCCTCTCTGTGCTTTTCTTCAACACCATGAGATATGAAGCAGCTGATCCTGGTAATGCTAACAATGATCGCTTTGTTTTGTCAAAGGGCCATGCTGCTCCCATCCTCTATGCTGCTTGGGCAGAGGCTGGCTACATCAAGGAATCGGACCTGCTCAACTTGAGGAAAATCGATTGTGACCTGGAAGGACATCCAACTCCTAAATTGCCCTTTGTTGATGTTGCAACTGGATCCTTAGGACAAGGGCTGGGGGCATCTTGTGGCATGGCATACACTGGGAAATACTTTGACAAGGCTAGTTACCGTGTCTACTGCTTATTGGGAGATGGTGAATCCTCTGAGGGAGCTGTCTGGGAAGCCATGGCCTTTGCCTCTCATTACCATTTGGACAACCTTGTGGCCATATTTGATGTCAACCGCTTGGGCCAGAGTGAAGCTGCACCTCTTCAGCACCAGACTGATATCTACATGAAGAGATGTGAAGCCTTTGGGTGGAACACCTATGTTGTGGACGGCCATGATGTGGCAGAGCTTTGCCATGCTTTCTGGCAGGCTGCTCACGTAAAGGACAAGCCCACAGCAATCATTGCTAAAACCTACAAGGGCAAAGGTATTTCAGGGGTTGAAAATGAAGATAACTGGCATGGAAAGCCTATGCCAAAAGACAAAGCTGAATCCATCATCAATGAAATCCAGAGTCAGATCCAGACCAATAGGAAGCTAAGCCCTCTGGTTCCCATTGCAGATGCACCAAAGATTAGCATTTCAGACATAACCTTTCCTTCTCCCCCAAACTACAAGATTGGTGACAAGATTGCAACCCGCAGAGCTTATGGCCTGGCTCTCGCTAAACTGGGACATGCAAACAGCAGAGTTATTGCCCTTGATGGAGACACAAAAAACTCCACTTTCTCCGAGATCTTTAAGAAGGAGCACCCAGACCGCTACATCGAATGCTTCATTGCTGAACAGAACATGGTGAGTGTGGCAATGGGATGTGCCACACGGAACCGCACAGTGGCTTTTGCCAGTACATTTGCTGCCTTCCTCTCAAGGGCCTATGATCACATTCGCATGGGGGCCATCTCACAGTCCAATGTCAATCTCTGTGGCTCTCACTGTGGAGTCTCCATTGGTGAGGATGGTCCTTCTCAGATGGCTTTGGAGGATCTTGCAATGTTCCGTGCTATTCCAACTTGTACAGTCTTCTATCCCAGTGATGGAGTTTCAACCGAACATGCTGTCTTTTTAGCAGCCAACACTCCAGGTATCTGCTTCATCCGAACCAGCCGCCCAGACACTGCTGTTATATATTCTCCAGATGAGAAGTTTGAAATTGGGCAAGCAAAGGTGGTGCGCCAGAGCAGCTCTGATAGGGTAACGGTTATTGGTGCTGGAGTGACTTTACATGAGGCCTTGGCAGCAGCTGATGAACTTGCTAAGCAAGGTATCAATATTCGTGTGGTTGACCCCTTTACCATTAAACCATTGGATGCTGCAACAATTCTATCCAGTGGTCGGGCAACTGGCGGACATATAATTACTGTGGAAGATCATTACAGAGAAGGTGGACTTGGAGAAGCAGTCTGCGCTGCAGTTGCAGGAGAACCAGGGTTCATTGTCCAAACTTTGGCTGTGCGTGGCGTCCCCCGAAGTGGAAAGCCAACGGAACTTCTAGACCTGTTTGGCATAAGTTCTAGATGCATTGTTGAAGCTGTTAAATCTACCTTTGCAAATTAA
Full Trace Sequence: cgcagcgctgcacaggttggagggagacaagcggaggctcataccatggacacttaccagaaaccagaagataaggagctgcaggccctcaaggatgcggccaaccggctgcggatccattccattagggcaacatgcgcctccaactcagggcatcccacctcctgctgcagtgctgctgaagtcctctctgtgcttttcttcaacaccatgagatatgaagcagctgatcctggtaatgctaacaatgatcgctttgttttgtcaaagggccatgctgctcccatcctctatgctgcttgggcagaggctggctacatcaaggaatcggacctgctcaacttgaggaaaatcgattgtgacctggaaggacatccaactcctaaattgccctttgttgatgttgcaactggatccttaggacaagggctgggggcatcttgtggcatggcatacactgggaaatactttgacaaggctagttaccgtgtctactgcttattgggagatggtgaatcctctgagggagctgtctgggaagccatggcctttgcctctcattaccatttggacaaccttgtggccatatttgatgtcaaccgcttgggccagagtgaagctgcacctcttcagcaccagactgatatctacatgaagagatgtgaagcctttgggtggaacacctatgttgtggacggccatgatgtggcagagctttgccatgctttctggcaggctgctcacgtaaaggacaagcccacagcaatcattgctaaaacctacaagggcaaaggtatttcaggggttgaaaatgaagataactggcatggaaagcctatgccaaaagacaaagctgaatccatcatcaatgaaatccagagtcagatccagaccaataggaagctaagccctctggttcccattgcagatgcaccaaagattagcatttcagacataacctttccttctcccccaaactacaagattggtgacaagattgcaacccgcagagcttatggcctggctctcgctaaactgggacatgcaaacagcagagttattgcccttgatggagacacaaaaaactccactttctccgagatctttaagaaggagcacccagaccgctacatcgaatgcttcattgctgaacagaacatggtgagtgtggcaatgggatgtgccacacggaaccgcacagtggcttttgccagtacatttgctgccttcctctcaagggcctatgatcacattcgcatgggggccatctcacagtccaatgtcaatctctgtggctctcactgtggagtctccattggtgaggatggtccttctcagatggctttggaggatcttgcaatgttccgtgctattccaacttgtacagtcttctatcccagtgatggagtttcaaccgaacatgctgtctttttagcagccaacactccaggtatctgcttcatccgaaccagccgcccagacactgctgttatatattctccagatgagaagtttgaaattgggcaagcaaaggtggtgcgccagagcagctctgatagggtaacggttattggtgctggagtgactttacatgaggccttggcagcagctgatgaacttgctaagcaaggtatcaatattcgtgtggttgacccctttaccattaaaccattggatgctgcaacaattctatccagtggtcgggcaactggcggacatataattactgtggaagatcattacagagaaggtggacttggagaagcagtctgcgctgcagttgcaggagaaccagggttcattgtccaaactttggctgtgcgtggcgtcccccgaagtggaaagccaacggaacttctagacctgtttggcataagttctagatgcattgttgaagctgttaaatctacctttgcaaattaatttcaggctgatccattcttcaggcgctataacaaacattttaacatcagcttcttccattcacctcctgcactacctcctccatcttgacaagttctaagtttgttgttgtctgtaaatgtcattcaacactagctggtctctagaatcctaacagtcccaagctgtctcctgtttcacactctcagcacttataataaagagaagaatgtcaaccaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDTYQKPEDKELQALKDAANRLRIHSIRATCASNSGHPTSCCSAAEVLSVLFFNTMRYEAADPGNANNDRFVLSKGHAAPILYAAWAEAGYIKESDLLNLRKIDCDLEGHPTPKLPFVDVATGSLGQGLGASCGMAYTGKYFDKASYRVYCLLGDGESSEGAVWEAMAFASHYHLDNLVAIFDVNRLGQSEAAPLQHQTDIYMKRCEAFGWNTYVVDGHDVAELCHAFWQAAHVKDKPTAIIAKTYKGKGISGVENEDNWHGKPMPKDKAESIINEIQSQIQTNRKLSPLVPIADAPKISISDITFPSPPNYKIGDKIATRRAYGLALAKLGHANSRVIALDGDTKNSTFSEIFKKEHPDRYIECFIAEQNMVSVAMGCATRNRTVAFASTFAAFLSRAYDHIRMGAISQSNVNLCGSHCGVSIGEDGPSQMALEDLAMFRAIPTCTVFYPSDGVSTEHAVFLAANTPGICFIRTSRPDTAVIYSPDEKFEIGQAKVVRQSSSDRVTVIGAGVTLHEALAAADELAKQGINIRVVDPFTIKPLDAATILSSGRATGGHIITVEDHYREGGLGEAVCAAVAGEPGFIVQTLAVRGVPRSGKPTELLDLFGISSRCIVEAVKSTFAN
Donor tissue: tailbud