ORFeome > MGC76296 – XORFeome 2.0

MGC76296 – XORFeome 2.0

General Information

Species: Xenopus tropicalis 26S protease regulatory subunit 7, mRNA (cDNA clone MGC:76296 IMAGE:5379538), complete cds
Gene Symbol: MGC76296
Gene ID: 394760
ORF gb_acc: MG132826
ORF ID: 10175

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061627

Library Location

Plate ID: GDExt11003
Well Location: H03

EST Sequences

Clone: MGC:76296 IMAGE:5379538
Trimmed Sequence: ATGCCTGACTATCTAGGAGCGGACCAGCGGAAGACAAAAGAAGAAGAAAAGGAGGACAAACCTATCAGATCTCTTGATGAAGGAGATATTGCATTGCTGAAAACCTATGGACAAAGCACTTATTCAAGGCAGATCAAGCAGGTAGAGGATGACATACAGCAACTGCTTAAGAAAATAAATGAGCTTACAGGTATTAAGGAGTCTGATACAGGACTTGCTCCTCCAGCACTGTGGGATTTGGCTGCAGATAAACAGACACTTCAGAGCGAGCAACCACTTCAAGTGGCAAGATGTACAAAAATAATAAATGCAGACTCAGAGGACCCAAAATACATTATTAATGTAAAACAGTTCGCTAAGTTTGTGGTAGACCTCAGTGATCAAGTTGCTCCTACTGACATTGAAGAGGGTATGAGAGTCGGTGTTGACAGGAACAAATACCAGATTCATATCCCTCTTCCTCCAAAGATTGATCCCACTGTAACAATGATGCAGGTAGAGGAGAAACCTGATGTAACATACAGTGATGTTGGAGGCTGCAAGGAACAAATAGAAAAATTGCGAGAAGTTGTGGAAACACCACTGCTTCATCCGGAGAGGTTTGTTAACCTTGGTATTGAGCCTCCCAAAGGAGTACTGCTGTTTGGACCTCCTGGAACTGGCAAAACGTTGTGTGCACGTGCTGTAGCCAACAGAACAGATGCCTGCTTCATCCGAGTCATTGGATCTGAGCTTGTGCAGAAATACGTGGGAGAGGGAGCCCGTATGGTGCGTGAGCTATTTGAGATGGCCAGAACCAAAAAAGCATGTCTTATTTTCTTTGATGAAATTGATGCCATTGGTGGGGCTCGTTTTGATGATGGAGCTGGAGGTGATAACGAAGTCCAGCGCACTATGCTAGAACTTATCAACCAGTTGGACGGCTTTGATCCCAGAGGAAACATTAAAGTGTTAATGGCCACTAACAGACCAGACACTTTGGATCCTGCTCTTATGAGACCTGGAAGACTGGACAGAAAAATTGAATTTAGTTTGCCCGATCTGGAGGGCCGTACGCACATATTTAAGATTCATGCACGTTCTATGAGTGTCGAGAGAGATATAAGATTCGAACTTCTGGCTCGGCTATGTCCTAACAGTACAGGAGCCGAAATTCGTAGCGTGTGCACAGAGGCTGGAATGTTCGCTATTCGAGCTCGCCGTAAAGTCGCAACTGAGAAAGATTTCTTAGAAGCTGTGAACAAGGTGATCAAGTCGTATGCAAAGTTCAGCGCTACCCCAAGATACATGACTTACAACTAA
Full Trace Sequence: tgtggatagacatcatgcctgactatctaggagcggaccagcggaagacaaaagaagaagaaaaggaggacaaacctatcagatctcttgatgaaggagatattgcattgctgaaaacctatggacaaagcacttattcaaggcagatcaagcaggtagaggatgacatacagcaactgcttaagaaaataaatgagcttacaggtattaaggagtctgatacaggacttgctcctccagcactgtgggatttggctgcagataaacagacacttcagagcgagcaaccacttcaagtggcaagatgtacaaaaataataaatgcagactcagaggacccaaaatacattattaatgtaaaacagttcgctaagtttgtggtagacctcagtgatcaagttgctcctactgacattgaagagggtatgagagtcggtgttgacaggaacaaataccagattcatatccctcttcctccaaagattgatcccactgtaacaatgatgcaggtagaggagaaacctgatgtaacatacagtgatgttggaggctgcaaggaacaaatagaaaaattgcgagaagttgtggaaacaccactgcttcatccggagaggtttgttaaccttggtattgagcctcccaaaggagtactgctgtttggacctcctggaactggcaaaacgttgtgtgcacgtgctgtagccaacagaacagatgcctgcttcatccgagtcattggatctgagcttgtgcagaaatacgtgggagagggagcccgtatggtgcgtgagctatttgagatggccagaaccaaaaaagcatgtcttattttctttgatgaaattgatgccattggtggggctcgttttgatgatggagctggaggtgataacgaagtccagcgcactatgctagaacttatcaaccagttggacggctttgatcccagaggaaacattaaagtgttaatggccactaacagaccagacactttggatcctgctcttatgagacctggaagactggacagaaaaattgaatttagtttgcccgatctggagggccgtacgcacatatttaagattcatgcacgttctatgagtgtcgagagagatataagattcgaacttctggctcggctatgtcctaacagtacaggagccgaaattcgtagcgtgtgcacagaggctggaatgttcgctattcgagctcgccgtaaagtcgcaactgagaaagatttcttagaagctgtgaacaaggtgatcaagtcgtatgcaaagttcagcgctaccccaagatacatgacttacaactaattccagcagctactgtttttggcaccattatctgttatgtagaacaatattgtgttggaatataaataaatagtaaaaactaaaaaaaaaaaaaaaaaaaaa
Translation: MPDYLGADQRKTKEEEKEDKPIRSLDEGDIALLKTYGQSTYSRQIKQVEDDIQQLLKKINELTGIKESDTGLAPPALWDLAADKQTLQSEQPLQVARCTKIINADSEDPKYIINVKQFAKFVVDLSDQVAPTDIEEGMRVGVDRNKYQIHIPLPPKIDPTVTMMQVEEKPDVTYSDVGGCKEQIEKLREVVETPLLHPERFVNLGIEPPKGVLLFGPPGTGKTLCARAVANRTDACFIRVIGSELVQKYVGEGARMVRELFEMARTKKACLIFFDEIDAIGGARFDDGAGGDNEVQRTMLELINQLDGFDPRGNIKVLMATNRPDTLDPALMRPGRLDRKIEFSLPDLEGRTHIFKIHARSMSVERDIRFELLARLCPNSTGAEIRSVCTEAGMFAIRARRKVATEKDFLEAVNKVIKSYAKFSATPRYMTYN
Donor tissue: tailbud