ORFeome > MGC76300 – XORFeome 2.0

MGC76300 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76300, mRNA (cDNA clone MGC:76300 IMAGE:5379673), complete cds
Gene Symbol: MGC76300
Gene ID: 394861
ORF gb_acc: MG132869
ORF ID: 10227

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063931

Library Location

Plate ID: GDExt11002
Well Location: E09

EST Sequences

Clone: MGC:76300 IMAGE:5379673
Trimmed Sequence: ATGGGCTGCACCGTGAGCGCAGAAGACAAAGCAGCAGCGGAGAGATCGAAAAACATCGATAAAAACCTGAGGGAGGATGGAGAGAAGGCGGCCAGGGAGGTGAAACTGCTGCTGCTGGGTGCCGGTGAATCCGGGAAGAGCACAATTGTCAAGCAGATGAAGATCATTCATGAGGATGGGTATTCTGAAGAAGAGTGCCGCCAGTATCGGGCTGTGGTCTTCAGCAACACCATTCAGTCCATTATGGCAATTATTAAGGCTATGGGCAACCTCAAGATAGATTTTGGAGACCCTGCCAGGGCGGATGATGCAAGGCAGTTATTTGCTCTCTCCAGCACTGCCGAAGAACAGGGTATACTCCCAGATGACCTGGCCGGGGTTATTCGCAGACTCTGGGCCGACCCAGGGGTACAGGCCTGCTTCAGCCGTTCCCGTGAATATCAGCTCAATGATTCTGCTGCATATTATCTGAATGATCTGGAGCGCATTGCTCGGTCTGATTATGTTCCTACTCAGCAAGATGTTCTCAGGACACGAGTGAAAACTACTGGAATCGTGGAGACACACTTCACCTTTAAAGACCTGCACTTCAAAATGTTTGATGTCGGGGGACAGCGTTCTGAGCGAAAGAAATGGATCCACTGCTTTGAGGGAGTGACTGCAATTATATTTTGCGTGGCGCTCAGTGCCTACGACCTGGTGTTGGCAGAGGATGAAGAGATGAATCGGATGCACGAGAGCATGAAATTATTTGACAGTATCTGTAACAACAAATGGTTCACCGAGACATCCATCATCCTCTTCCTCAACAAAAAGGATCTCTTTGAGGAGAAGATCACCCGCAGCCCTCTCAGTATCTGCTTCCCTGAGTACTCTGGTGCCAATCAGTACGACGAAGCTGCTAGTTACATCCAGACTAAGTTTGAGGATTTAAACAAGAGGCGTGACACAAAGGAGATATACACACATTTCACATGTGCCACCGACACAAAAAATGTACAGTTTGTGTTTGATGCTGTGACGGACGTGATCATCAAGAACAACCTGAAGGACTGTGGCCTTTTCTAA
Full Trace Sequence: cacagagcggagctgagtggcgttacatctctatcgctctctctgtggcgctggggctgcaccttgggcttcattagtcgggacattggggacatttccagcgcagcctgtgccgtggaggtgcccgggaaaagcggcgggtggggccgtgggtcgcggtctaacgcactatctggggctgtgtcgcgacatatcgctgccatgggctgcaccgtgagcgcagaagacaaagcagcagcggagagatcgaaaaacatcgataaaaacctgagggaggatggagagaaggcggccagggaggtgaaactgctgctgctgggtgccggtgaatccgggaagagcacaattgtcaagcagatgaagatcattcatgaggatgggtattctgaagaagagtgccgccagtatcgggctgtggtcttcagcaacaccattcagtccattatggcaattattaaggctatgggcaacctcaagatagattttggagaccctgccagggcggatgatgcaaggcagttatttgctctctccagcactgccgaagaacagggtatactcccagatgacctggccggggttattcgcagactctgggccgacccaggggtacaggcctgcttcagccgttcccgtgaatatcagctcaatgattctgctgcatattatctgaatgatctggagcgcattgctcggtctgattatgttcctactcagcaagatgttctcaggacacgagtgaaaactactggaatcgtggagacacacttcacctttaaagacctgcacttcaaaatgtttgatgtcgggggacagcgttctgagcgaaagaaatggatccactgctttgagggagtgactgcaattatattttgcgtggcgctcagtgcctacgacctggtgttggcagaggatgaagagatgaatcggatgcacgagagcatgaaattatttgacagtatctgtaacaacaaatggttcaccgagacatccatcatcctcttcctcaacaaaaaggatctctttgaggagaagatcacccgcagccctctcagtatctgcttccctgagtactctggtgccaatcagtacgacgaagctgctagttacatccagactaagtttgaggatttaaacaagaggcgtgacacaaaggagatatacacacatttcacatgtgccaccgacacaaaaaatgtacagtttgtgtttgatgctgtgacggacgtgatcatcaagaacaacctgaaggactgtggccttttctaaccaacagggccgagccattgatgtgtgcgggttggggagggaagcaccttccaggcgtctgtggattttacagtttttatcccaagtttgttgcattttgtaattttacctttctcctgctggatcaaagtgtgctgaatggagcaatgctctttcaaaagctgtgcttctcaggccgtgctggacagtgtacagttcataccaattttcactttttataaacctggaacattgcctgtgctgccaggggaaagcattttggaagcctccccgtgtctttaaggaagtccaaggccatcctgaatcattcctggatcccacaagcagttgctatttccctggggggcacttcatgtctgttctggatacccccccgtaccctttaaaccaagggctgttttggaccgtttcatgttgcatataaaaagcaccagcctctgatttctgatgcatctttgtgcacgtgcatgcaagtggtaatggtgatttattccctccttggtcacaaagacttcacatctgcaggcccaaccagctgcaatggatcaacccattctgtagttacagctcccctgctagttgagccttcagtagtccagtacaaaaagcctttggccaccagcattcctaccttcataacattcttcttgattactgactgccagaatagacccagctcagggtttgttgcctgcggcagtggactccttacattttttgttttgcccaaatgctacatgaaagagcagagaaggtgcagtactggcaatgaaggattaacccttccctgctgattcacattcctttttaaaatcttactaaagaaagaaaccatgaaatgcaaatgataactagaataattagctgggggtggagccttctacctggggaaagttggggggcggggggggggggtggaaggtccccccagaaggtttccaccagtagctttttgtgcctttggctgatctgtgtgtttttatattttattttgttttattaattattgtaactttagctcagtaaaaacctcattaatattatgctctttattaaccctttcttcttcctcaacctcattatttcctacttcttctctttctcagttctccttccatagcctctaaatacccctaaggctccactctctctctttctgtcctttccgataagcacttcccccccgccaacataaactgctgtgattttgtggcagcaaaggagttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGCTVSAEDKAAAERSKNIDKNLREDGEKAAREVKLLLLGAGESGKSTIVKQMKIIHEDGYSEEECRQYRAVVFSNTIQSIMAIIKAMGNLKIDFGDPARADDARQLFALSSTAEEQGILPDDLAGVIRRLWADPGVQACFSRSREYQLNDSAAYYLNDLERIARSDYVPTQQDVLRTRVKTTGIVETHFTFKDLHFKMFDVGGQRSERKKWIHCFEGVTAIIFCVALSAYDLVLAEDEEMNRMHESMKLFDSICNNKWFTETSIILFLNKKDLFEEKITRSPLSICFPEYSGANQYDEAASYIQTKFEDLNKRRDTKEIYTHFTCATDTKNVQFVFDAVTDVIIKNNLKDCGLF
Donor tissue: tailbud