ORFeome > MGC76326 – XORFeome 2.0

MGC76326 – XORFeome 2.0

General Information

Species: Xenopus tropicalis similar to calsequestrin 2 (cardiac muscle), mRNA (cDNA clone MGC:76326 IMAGE:5380471), complete cds
Gene Symbol: MGC76326
Gene ID: 394741
ORF gb_acc:
ORF ID: 10249

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061441

Library Location

Plate ID: GDExt11002
Well Location: H07

EST Sequences

Clone: MGC:76326 IMAGE:5380471
Trimmed Sequence: ATGTTCTGCCTCTGGCTCCTCATACTGGGGGCCCTGGGGCCCTTGGGCAACTCTGAGGAAGGCCTCCATTTCCCCACATATGATGGCAAAGACCGGGTCCTGGAGCTGGGGGAGAAGAACTACAGGCAGCTGATGAAGAAACATGAGGTGTTCTGTGTCCTGCTCCAAACTGCACCCCCACCCGGGGACAAGGGTGCCCAGCGGCGCCTCCACCTGACCGAGATGGTGCTGGAGCTCACAGCTCAGGTTCTGGAGAGGAAGCAAATTGGATTTGGACTACTAGACCCAAAGAAGAATTCCAAGATTGCAAAAAAACTTGGGTGCTCTGAGGAGGGCAGTCTCTATATCTTTAAGGAGGACAATGTCATCGAGTTCGATGGGGAGATGGCGGCCGACGTTATCGTAGATTTCCTTCTCGACCTGATGGAGGATCCAGTGGAAGTCATTAACAGCAAGGCGGAGCTGAAGGTCCTGGACCACATGGAGGAGGAAATGAAACTAATTGGCTACTTTAAGGGCGAGGATTCTGAGTATTACAAAGACTATGAAGAAGCCGCGGAACATTTCCATCCTTTTATCAAGTTCTTTGCAACCTTTGAGAAGTCGGTGGCCAAGGCCCTCAGCCTGAAGATGAACGAGGTGGACTTCTATGAGCCTTTCATGGAGGAGCCTGTGACCATTCCAGATAAACCCTACAGCGAGGAGGAACTGGTGGACTTTATCCACAAGCACAAAAGAGCCACATTGCGCAAGCTCCGCCCAGAAGATATGTTTGAGACCTGGGAGGACGACCTGGACGGGATCCACATTGTGGCGTTTGCAGAGGAGGAGGATCCAGACGGTTACGAGTTCCTCCAGATCCTGAAGGAGGTTGCGCGGGAGAACACGGAGAATCCAGAGCTGAGTATCATCTGGATCGACCCCGATAACTTCCCTCTGCTGGTTTCCTATTGGGAGAAGACATTTCACATCGACCTGTTCCGACCGCAGATAGGAGTTGTCAATGTTACAGATGCCGACAGCGTCTGGATGGAAATGAAAGATGCCGAAGATCTGCCCTCGGCCGACGAGCTGGAGCAGTGGATAGAGGATGTCCTGTCTGGTAAAGTCAATACAGAAGATGATGATGATGATGACGACGATGATGATGATGACGATGATGACGATGATGATGACGACGATGATGATGATGATGACGATGACGATGACGACGACGATGATGATGATGACGACGATGATTACTAA
Full Trace Sequence: tgcgacaatgttctgcctctggctcctcatactgggggccctggggcccttgggcaactctgaggaaggcctccatttccccacatatgatggcaaagaccgggtcctggagctgggggagaagaactacaggcagctgatgaagaaacatgaggtgttctgtgtcctgctccaaactgcacccccacccggggacaagggtgcccagcggcgcctccacctgaccgagatggtgctggagctcacagctcaggttctggagaggaagcaaattggatttggactactagacccaaagaagaattccaagattgcaaaaaaacttgggtgctctgaggagggcagtctctatatctttaaggaggacaatgtcatcgagttcgatggggagatggcggccgacgttatcgtagatttccttctcgacctgatggaggatccagtggaagtcattaacagcaaggcggagctgaaggtcctggaccacatggaggaggaaatgaaactaattggctactttaagggcgaggattctgagtattacaaagactatgaagaagccgcggaacatttccatccttttatcaagttctttgcaacctttgagaagtcggtggccaaggccctcagcctgaagatgaacgaggtggacttctatgagcctttcatggaggagcctgtgaccattccagataaaccctacagcgaggaggaactggtggactttatccacaagcacaaaagagccacattgcgcaagctccgcccagaagatatgtttgagacctgggaggacgacctggacgggatccacattgtggcgtttgcagaggaggaggatccagacggttacgagttcctccagatcctgaaggaggttgcgcgggagaacacggagaatccagagctgagtatcatctggatcgaccccgataacttccctctgctggtttcctattgggagaagacatttcacatcgacctgttccgaccgcagataggagttgtcaatgttacagatgccgacagcgtctggatggaaatgaaagatgccgaagatctgccctcggccgacgagctggagcagtggatagaggatgtcctgtctggtaaagtcaatacagaagatgatgatgatgatgacgacgatgatgatgatgacgatgatgacgatgatgatgacgacgatgatgatgatgatgacgatgacgatgacgacgacgatgatgatgatgacgacgatgattactaaaatatcattcacaccaagaactgaaacattggctgatctgggccaataccctttatatcccattaacattggtccgttccatgcagaaccagaggcccagaacctgatgtggttccgcaaacccggtgcagtatctgtccttctcttacagatcctccaaatatctcaacatcatctacggaaaccgcgttcccctggaatcctacactcctgattggttaatcctgtcggcacggagatcctggaactcactctccaagaaacacggagacgcccagtgggtcaaaatagccattttatctgagtcgggggttttgtttcttctgtgttcatgagttttgtcccctggggcagagttttggtactgggctgattagttgccccccaaataaactgtcgtaggttctttccatcgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MFCLWLLILGALGPLGNSEEGLHFPTYDGKDRVLELGEKNYRQLMKKHEVFCVLLQTAPPPGDKGAQRRLHLTEMVLELTAQVLERKQIGFGLLDPKKNSKIAKKLGCSEEGSLYIFKEDNVIEFDGEMAADVIVDFLLDLMEDPVEVINSKAELKVLDHMEEEMKLIGYFKGEDSEYYKDYEEAAEHFHPFIKFFATFEKSVAKALSLKMNEVDFYEPFMEEPVTIPDKPYSEEELVDFIHKHKRATLRKLRPEDMFETWEDDLDGIHIVAFAEEEDPDGYEFLQILKEVARENTENPELSIIWIDPDNFPLLVSYWEKTFHIDLFRPQIGVVNVTDADSVWMEMKDAEDLPSADELEQWIEDVLSGKVNTEDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDY
Donor tissue: tadpole