ORFeome > MGC79786 – XORFeome 2.0

MGC79786 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC79786 protein, mRNA (cDNA clone MGC:79786 IMAGE:6986003), complete cds
Gene Symbol: MGC79786
Gene ID: 493247
ORF gb_acc: MG133771
ORF ID: 11342

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC079962

Library Location

Plate ID: GDExt11013
Well Location: D04

EST Sequences

Clone: MGC:79786 IMAGE:6986003
Trimmed Sequence: ATGAAGCCCCCCTCGCGCCAGCGTTCTGCGCCAGTCAGGTACGAAATCCAAGGCATCCATCTGAGACGGACCGGTCCCTACCGCCTGGCATGGACGTTCAAAGAGAAACATGAGTTACTAAAGGGGCTGAAAGCGCAGAAGGATAAAAAGGAGGCCGAGATACCCGTCCAGGGGCGGAGCCAGACAGAGGTTGCTTCTTACATCTCGTGGCTGCGAGGCCGCGCTGCTCGGGAAGCCATACAGACGGAATATGAGCGCTGGGTGCACAAGAGGAGATCCACGTGTAATCAAAGCCCGGCCCCTATAGATCTGTGGACGGATATGGCGCGCACCGTGTCAGAACCTGCAGAAGAAGCTTTAACGGCAGCTTTCTCCCAGATGCTGACTATCGCAGCCACAGAGCCCATCAGCTTAAAACACTCGATCCCTAGTAGGTTTCCCGACGGCAAAACACAGTCCGCCTCTCACAATGACCCGCAAAAATCCCATGGATCGGTAGAAAATAGTCAAAGAAAGGAACCTCTAGCAGAGGCACCCGGACTCTCAGCATCTCAGCCCTCGCCGCCACTGGATGATGCCGAAGACCAATGGACAGGGCTGGACTATGAGAAGATTTACAAGTACCTATCGAAAGCTGCCAAAGGGGAAGAGCTGCCCAAACTCTCCAAAGTGGAATCTGCTGTGCTGCTCTGTCTCCTTCACGCGCTCCCTGACCAAGTACAGATGCTTGATTGGCAGCCTCTCGCATCATTCCTCCGCCAAGCCTACTCAAGCCTCAACTCCATGGCACAATCCTCGGACTCTGTGACGCAGGAGAATACAGGCGATGGCCACGCTTCTCCAGAGGATTCAGTGGATGACCAGCTTTGTTCAGTGGGCAACCAGTCCAATCAGACTGCACCACCAAGTGCTAAGGACAACTCAGTAGGTGACCATTCCACCCAAAATGCAGCGGGAGATAAGGACAATCTATCATGTGACCCACCAACTCAGAAGGCTGCTTTGGGTGACCAACATGCTCCGGAAAATCCATTGCGGACCACTCAGGAGAATCCTCTGGGTGAAAAATCCACGGTGAGGGACCTTTCTGCTTCGAATAACACAGTGACGAATCCACCGAATCAGAACACAGCCGAGGACCAACCCGGTCCGAACTGGAAGGAGTTAAAGTTCTGTCCCTTAAACCCTTTTATGATCCCTTTGAACCTCCTGAAGCAGAAAGAGACGGAGTGCTAG
Full Trace Sequence: gtttaattgcacggttggagctgtgtcccagtagctgttggttcatggctgcacataaatgagtgaaggaaacatgtaaaggaagtagctgttagtgtaaggggccaggtttagagactatgaaacatgaagcccccctcgcgccagcgttctgcgccagtcaggtacgaaatccaaggcatccatctgagacggaccggtccctaccgcctggcatggacgttcaaagagaaacatgagttactaaaggggctgaaagcgcagaaggataaaaaggaggccgagatacccgtccaggggcggagccagacagaggttgcttcttacatctcgtggctgcgaggccgcgctgctcgggaagccatacagacggaatatgagcgctgggtgcacaagaggagatccacgtgtaatcaaagcccggcccctatagatctgtggacggatatggcgcgcaccgtgtcagaacctgcagaagaagctttaacggcagctttctcccagatgctgactatcgcagccacagagcccatcagcttaaaacactcgatccctagtaggtttcccgacggcaaaacacagtccgcctctcacaatgacccgcaaaaatcccatggatcggtagaaaatagtcaaagaaaggaacctctagcagaggcacccggactctcagcatctcagccctcgccgccactggatgatgccgaagaccaatggacagggctggactatgagaagatttacaagtacctatcgaaagctgccaaaggggaagagctgcccaaactctccaaagtggaatctgctgtgctgctctgtctccttcacgcgctccctgaccaagtacagatgcttgattggcagcctctcgcatcattcctccgccaagcctactcaagcctcaactccatggcacaatcctcggactctgtgacgcaggagaatacaggcgatggccacgcttctccagaggattcagtggatgaccagctttgttcagtgggcaaccagtccaatcagactgcaccaccaagtgctaaggacaactcagtaggtgaccattccacccaaaatgcagcgggagataaggacaatctatcatgtgacccaccaactcagaaggctgctttgggtgaccaacatgctccggaaaatccattgcggaccactcaggagaatcctctgggtgaaaaatccacggtgagggacctttctgcttcgaataacacagtgacgaatccaccgaatcagaacacagccgaggaccaacccggtccgaactggaaggagttaaagttctgtcccttaaacccttttatgatccctttgaacctcctgaagcagaaagagacggagtgctagctcacacagccatttttctgcccacgttttcacctcgcttcaatatgttcacgcagccaataggaaatgagaggggacattgcccgcccaaatgactgctctttacgtgtatttcttttatgttcccacaggtactgtacggaacgcgtcgcacttctatgttccgcagagttaattaaatgcaatggaacccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MKPPSRQRSAPVRYEIQGIHLRRTGPYRLAWTFKEKHELLKGLKAQKDKKEAEIPVQGRSQTEVASYISWLRGRAAREAIQTEYERWVHKRRSTCNQSPAPIDLWTDMARTVSEPAEEALTAAFSQMLTIAATEPISLKHSIPSRFPDGKTQSASHNDPQKSHGSVENSQRKEPLAEAPGLSASQPSPPLDDAEDQWTGLDYEKIYKYLSKAAKGEELPKLSKVESAVLLCLLHALPDQVQMLDWQPLASFLRQAYSSLNSMAQSSDSVTQENTGDGHASPEDSVDDQLCSVGNQSNQTAPPSAKDNSVGDHSTQNAAGDKDNLSCDPPTQKAALGDQHAPENPLRTTQENPLGEKSTVRDLSASNNTVTNPPNQNTAEDQPGPNWKELKFCPLNPFMIPLNLLKQKETEC
Donor tissue: tadpole