ORFeome > MGC88900 – XORFeome 2.0

MGC88900 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC88900 protein, mRNA (cDNA clone MGC:88900 IMAGE:6998731), complete cds
Gene Symbol: MGC88900
Gene ID: 448215
ORF gb_acc: MG134062
ORF ID: 11681

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075273

Library Location

Plate ID: GDExt11016
Well Location: E06

EST Sequences

Clone: MGC:88900 IMAGE:6998731
Trimmed Sequence: ATGGCTGGAATCAAAACATCCAGTGGAGAATACATTGACTCCTCCTGGGAGCTCAAAATCTACGTAGAAGATATGGGGCCCGATGCGGATCCAGTAACATTCAGAGTGACAGGCGAAACTCATATTGGGGGTGTGATATTACAGGCAGTAGAAAAAATAGGAATATCTCAGGACTGGTCAGACCATGCCATATGGTGGCAACAGAAGTGTCAGTGGCTGCTGAAAACCAGCTGGACTCTTGACAAATATGGTGTTCTGGCTGATGCCCGCCTCATCTTCACTTCTCAGCACAAGCCTGTCATCCTGTCTCTGCCTAACCAGCGCTCTCTGCGCATCAGGGTCTGCTTCTCTAGCACCACTTTCAGTGCATGTGCCGAAGTCTGCAAGGTTCTAGGTATTAGATACCCCGAAGAGCTTTCTTTCCTAAAGGCACCAGAAGATAAAGAGAAAAAGAAGAAAAAGAAAGATCCTGTCACTCAAGAGATATTTGACCTCACCTCCCTGCAGCCCTCTGATGGCTCTGCAGTATTGTTGCAGCAGGGGGGGATCCCAGCTCATTTCCTTGCTAGCCCTGAGGCACAAGAAGGTTACCGAGCTCTATCAGTCTGTCAAACAGCCTTAACCCCAGAAGACATCCAGAAACGATATAAACCAATTACTGTGACTGACAAAACCTTAATCCATGGCAGGTGGCTGAACTCCTCCAAATCTCTCATGCAGCAGGGGGTGCAGGAAGGAGACAGACTCTGGCTGCATTTCAAATATTACACTTTTCACGACTTGGACCCAAAGCTGGATGTTGTCCGGATCAACCTTCTGTTTGAGCAGGCACGATGGGCAGTGCTACTAGAAGAGACTGAGTGCACAGAAGAGGAAATGATGGTGTTCGCTGCTCTACAGTATCATGTGAATAAATTGTCAGTGACCTCTAATCCAATGGATTTGCCACAGGACCCAGCGCTGCAGGATCTTGAAGAAGCATTGTCCAATCTGGAGGTTAAAATGGATGCAAATACTCCCAGTGAGGCCCTGGAAGGAATCCAGTTAGAACCCGGTCTACAAGAATACCTCCGAGTGTTTAGACCAAAGAAAATGACACTGAAAGGCTATAAACAGAACTGGGTGCTGCTGAAAGATACTAATTTGTCATGTTATAAGAGCAAAGAAGAGACCAGAGGGGAGCCACTGATCATGTTCGGTCTGAAGGGGTGTGAAGTAATACCAGAGGTCAACATATCCTCCCAAAAGTTCTGCATCAGGCTTCTAGTCCCAACCCCAGAAGGAATGAATGAGGTTTACCTGCGTTGTGATGATGAGCAACAGTATGCCCGCTGGATGGCTGGTTGTCGCTTAGCAGCTAAAGGGCGCACGATGGGTGATGCATCCTATGAGGGTGAAGTGCAGAGTGTCCTGTCATTCTTAAACCTACAAAAATCCACCACCACCCAATCGAACACCACAGCCTCAGACTCCATCAATGTTCATGCCTTAGTGTCTCCACGATTCCAAAAGAAACTAAAACCCAAGCAGTTGACGCCGCGTATCTTGGAAGCGTATCAGAACATAGCGCAACTGTCTCTCATAGATGCCAAACAGCGGTTTATTCAAGCCTGGCAGTCCCTGCCTGACTTTGGGGTCTCATACTTTCTTGTAAGGTTTCCATTGAATTCACAGAGCACATAA
Full Trace Sequence: ggagagagcagaggtgtgcaagtcaaagagacttctcagaaagtcaaagcgctcattactaaagggggtacaaaagaagccaactaagtgctcataggcaccaaaagcgctaactagatggttggggtgtgaaggcatgagaagagcgcacagagagcaaagagacacttacaaataaaaagctagagaaaactaaaacaaccaaaagtgctgatgatctaaggatggctggaatcaaaacatccagtggagaatacattgactcctcctgggagctcaaaatctacgtagaagatatggggcccgatgcggatccagtaacattcagagtgacaggcgaaactcatattgggggtgtgatattacaggcagtagaaaaaataggaatatctcaggactggtcagaccatgccatatggtggcaacagaagtgtcagtggctgctgaaaaccagctggactcttgacaaatatggtgttctggctgatgcccgcctcatcttcacttctcagcacaagcctgtcatcctgtctctgcctaaccagcgctctctgcgcatcagggtctgcttctctagcaccactttcagtgcatgtgccgaagtctgcaaggttctaggtattagataccccgaagagctttctttcctaaaggcaccagaagataaagagaaaaagaagaaaaagaaagatcctgtcactcaagagatatttgacctcacctccctgcagccctctgatggctctgcagtattgttgcagcagggggggatcccagctcatttccttgctagccctgaggcacaagaaggttaccgagctctatcagtctgtcaaacagccttaaccccagaagacatccagaaacgatataaaccaattactgtgactgacaaaaccttaatccatggcaggtggctgaactcctccaaatctctcatgcagcagggggtgcaggaaggagacagactctggctgcatttcaaatattacacttttcacgacttggacccaaagctggatgttgtccggatcaaccttctgtttgagcaggcacgatgggcagtgctactagaagagactgagtgcacagaagaggaaatgatggtgttcgctgctctacagtatcatgtgaataaattgtcagtgacctctaatccaatggatttgccacaggacccagcgctgcaggatcttgaagaagcattgtccaatctggaggttaaaatggatgcaaatactcccagtgaggccctggaaggaatccagttagaacccggtctacaagaatacctccgagtgtttagaccaaagaaaatgacactgaaaggctataaacagaactgggtgctgctgaaagatactaatttgtcatgttataagagcaaagaagagaccagaggggagccactgatcatgttcggtctgaaggggtgtgaagtaataccagaggtcaacatatcctcccaaaagttctgcatcaggcttctagtcccaaccccagaaggaatgaatgaggtttacctgcgttgtgatgatgagcaacagtatgcccgctggatggctggttgtcgcttagcagctaaagggcgcacgatgggtgatgcatcctatgagggtgaagtgcagagtgtcctgtcattcttaaacctacaaaaatccaccaccacccaatcgaacaccacagcctcagactccatcaatgttcatgccttagtgtctccacgattccaaaagaaactaaaacccaagcagttgacgccgcgtatcttggaagcgtatcagaacatagcgcaactgtctctcatagatgccaaacagcggtttattcaagcctggcagtccctgcctgactttggggtctcatactttcttgtaaggtttccattgaattcacagagcacataaatgtggcttttacttgtgtctctgctccttgcaaagttgtacatgagtatattgggggctacatcttcatgtcaacacggggcaaagatggagggtctaaaactctaaacgaagagctgttccataagctgactggtgggcatgaggccctttgaatttctgcaccatatagttcatgtaatatatggtttctattatcacatttttttctgtaaatggccttgtaattctcccaggctatgcaacacactgtttcagccaatatttccacgtcacactggtgtgtgggtcaacagtagccattttttttttccacatgggtaattttttcaataagttcaacagtaagaaaactttacaaacccttcacaccctcatacactgcatatcaaacatgtagaggcagcactaatatggttctatatgtacaatcaatgagcttcaacctattggtgtttctgaggcacaaccattgattttgcagaatatagcgatcttgaaagattacagatctgagccccaataacccttaaatctgccagtaaaggtaatttatatgtgcaaattaaatagttcattttagatggattaatataccttttacattatgtacagattactagagtatgtaatctttatggatcaatctaaaggacttttgttttatgtaaactgttgttttcacaaaatatatatctatgcacaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAGIKTSSGEYIDSSWELKIYVEDMGPDADPVTFRVTGETHIGGVILQAVEKIGISQDWSDHAIWWQQKCQWLLKTSWTLDKYGVLADARLIFTSQHKPVILSLPNQRSLRIRVCFSSTTFSACAEVCKVLGIRYPEELSFLKAPEDKEKKKKKKDPVTQEIFDLTSLQPSDGSAVLLQQGGIPAHFLASPEAQEGYRALSVCQTALTPEDIQKRYKPITVTDKTLIHGRWLNSSKSLMQQGVQEGDRLWLHFKYYTFHDLDPKLDVVRINLLFEQARWAVLLEETECTEEEMMVFAALQYHVNKLSVTSNPMDLPQDPALQDLEEALSNLEVKMDANTPSEALEGIQLEPGLQEYLRVFRPKKMTLKGYKQNWVLLKDTNLSCYKSKEETRGEPLIMFGLKGCEVIPEVNISSQKFCIRLLVPTPEGMNEVYLRCDDEQQYARWMAGCRLAAKGRTMGDASYEGEVQSVLSFLNLQKSTTTQSNTTASDSINVHALVSPRFQKKLKPKQLTPRILEAYQNIAQLSLIDAKQRFIQAWQSLPDFGVSYFLVRFPLNSQST
Donor tissue: