ORFeome > MGC89091 – XORFeome 2.0

MGC89091 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89091 protein, mRNA (cDNA clone MGC:89091 IMAGE:7006209), complete cds
Gene Symbol: MGC89091
Gene ID: 448580
ORF gb_acc: MG134098
ORF ID: 11722

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076914

Library Location

Plate ID: GDExt11017
Well Location: E08

EST Sequences

Clone: MGC:89091 IMAGE:7006209
Trimmed Sequence: ATGCTTATAGATGATGGAATCCCGCCAACCAAGAAGCCCAGAAAGCTTTTGCCAAGTCTGAAGACAAAGAAACCTCAGGAGCTTGTTTTGGTAATTGGAACAGGTATTAGTTCTGCTGTTGCACCTCAGGTTCCTGCTTTAAAATCTTGGAAGGGACTAATCCAGGCCCTTCTTGATGCTGCTAATGACTTTGACTTGCTGGAAGAGGAGGAAAGCAAAAAGTTCCAGAAATGCCTTCATGAGGACAAGAACCTTATTCACGTGGCTCATGACTTAATTCAGAAGTTGTCACCACGTACTAGCAATGTGCGGTCCACCTTTTTTAAAGACTGCTTGTATGAGGTGTTTGATGATCTTGAATCAAAGATGGAGGACTCTGGAAAACAGCTTTTACAGTCAGTGCTACAACTAATGGAGCATGGAGCCCTTGTTCTGACCACTAATTTTGACAACTTGCTTGAAATATATGCCATTCATCAAGGAAAGCAACTTGAATCATTAGACTTGACAGATGAAAAAAAGGTCTTGGAGTGGGCTCAAGAGAAAAAAAAGCTGAGTGTTTTACACATACATGGAGTGTACACAAACCCCAGTGGTATTGTCCTCCACCCAGCTGGCTACCAGAATGTGCTAAGGAATACGGAAGTCATGAGAGAGATCCAGAAGCTGTATGAAACAAAGTCATTCCTTTTCCTTGGCTGTGGTCGCACTGTGGATGATACAACATTTCAGGCGCTCTTTCTGGAGGCAGTAAAACATAAGTCTGACTTGGAGCATTTCATGTTGGTTCGCAGAGAGGATGTAGAGGAGTTCAAAAAGCTGAGAGAAAATATGCTGGATAAGGGCATCAAAGTGATCTCTTATGGCACTGAGTACACTGATTTGCCAGAATACTTTGAGAGGCTTGCTAATGAGATCTCTACTAAAGGACGCACTGGTAACAGCACATGA
Full Trace Sequence: cattgagctgtgtaggagccggcggacactaaaggaaagtatttggcagcgcaatacagtggggattatagagctacaccaggctggtaacaggtgcccggctgtgcgtattgcaggaaggttttgccgaatgaaaccgtaatgcatttgtgaaatttaaaattttgggtgttctgctcctgtttattggatggcttctgcactaactgtaaagtctgagagccaaatgcttatagatgatggaatcccgccaaccaagaagcccagaaagcttttgccaagtctgaagacaaagaaacctcaggagcttgttttggtaattggaacaggtattagttctgctgttgcacctcaggttcctgctttaaaatcttggaagggactaatccaggcccttcttgatgctgctaatgactttgacttgctggaagaggaggaaagcaaaaagttccagaaatgccttcatgaggacaagaaccttattcacgtggctcatgacttaattcagaagttgtcaccacgtactagcaatgtgcggtccaccttttttaaagactgcttgtatgaggtgtttgatgatcttgaatcaaagatggaggactctggaaaacagcttttacagtcagtgctacaactaatggagcatggagcccttgttctgaccactaattttgacaacttgcttgaaatatatgccattcatcaaggaaagcaacttgaatcattagacttgacagatgaaaaaaaggtcttggagtgggctcaagagaaaaaaaagctgagtgttttacacatacatggagtgtacacaaaccccagtggtattgtcctccacccagctggctaccagaatgtgctaaggaatacggaagtcatgagagagatccagaagctgtatgaaacaaagtcattccttttccttggctgtggtcgcactgtggatgatacaacatttcaggcgctctttctggaggcagtaaaacataagtctgacttggagcatttcatgttggttcgcagagaggatgtagaggagttcaaaaagctgagagaaaatatgctggataagggcatcaaagtgatctcttatggcactgagtacactgatttgccagaatactttgagaggcttgctaatgagatctctactaaaggacgcactggtaacagcacatgaggtggcatgaacacaaggtttgcctgaagatagtgacaggccaacaagggaaacgcagaataaacacatcctgtgaaaaacagctattttgctatgcacacatcttagcaagcttgaatatagctttttgtggcttaatcaggcattgaaaatcatgtatcagtagcttatcttcctttacttgttattttgcttgtttgctaaagcatcttacacaaaacttatgaaatggatttactgcaatggcgtaatattggtataaaagagggctgtttatatcacaatttcaatataaatgtatattgtaagtcaggtgtcagaggaaatctgtatcaaaggagtatatatccatcagtgtaaaatgagaatatcatggctaaattagaccacttttatgatgttggaattatagttataccattgactttctgcagtttaattttgacttctattctctataacatgctgaaatggactataccagctgatcagaaacaagcaagaacttgggagctttaactgatctgtggcccctgatgattctgcacataatatattgctgattgtagtgtaatacaatagattttactaaaataaatatcccatcattaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MLIDDGIPPTKKPRKLLPSLKTKKPQELVLVIGTGISSAVAPQVPALKSWKGLIQALLDAANDFDLLEEEESKKFQKCLHEDKNLIHVAHDLIQKLSPRTSNVRSTFFKDCLYEVFDDLESKMEDSGKQLLQSVLQLMEHGALVLTTNFDNLLEIYAIHQGKQLESLDLTDEKKVLEWAQEKKKLSVLHIHGVYTNPSGIVLHPAGYQNVLRNTEVMREIQKLYETKSFLFLGCGRTVDDTTFQALFLEAVKHKSDLEHFMLVRREDVEEFKKLRENMLDKGIKVISYGTEYTDLPEYFERLANEISTKGRTGNST
Donor tissue: