ORFeome > MGC89138 – XORFeome 2.0

MGC89138 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC89138, mRNA (cDNA clone MGC:89138 IMAGE:7007460), complete cds
Gene Symbol: MGC89138
Gene ID: 779633
ORF gb_acc: MG134208
ORF ID: 11859

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC082503

Library Location

Plate ID: GDExt11017
Well Location: C12

EST Sequences

Clone: MGC:89138 IMAGE:7007460
Trimmed Sequence: ATGGGATCCCTGATCAAAGTGCTTCTCTTGTGCTGTGCGACTCTGGAAATCTATGGAACAGAGGATGCAAGACCACTATTGACGACAAAGTATGGGCAGCTTCTTGGAAACACAGTTGGCGCAAAGGAAACAGATAGATTAGTTCATGTTTTTATGGGCGTCCCCTTTGCAAAGCCACCTATCGGACCATTAAGATTTGAGGCTCCGCAGCCACCGGAGCCATGGAGCTCTGTCAGGGAAGCCACAGCCGCTCCACCCATGTGTTTACAAGATAAAAGAGGAATGGAAGCCCTTGCTAAATATTTCAAGGCAGAGTTTGATTTTCCTCCAGTTTCAGAGGATTGTTTGTACCTAAATGTCTTCACTCCAGCAGACAGAGGAGAGAACCCAGAGCTCCCTGTCATGGTGTTCATACATGGAGGAGGACTTACTATGGGAGGAGCATTCATGTTTGAAGGCACTGCTTTATGTGCCTATGAAAATGTTGTTGTGGTGTCAATCCAGTATAGACTTGGCATTATGGGATTCTTTAGTTCTGGTGATAAAGAAGTACGTGGGAACTTTGGATTTCTGGATCAGGTTGCAGCTTTACAATGGGTTCGTGATAATATTAAGGATTTTGGAGGAAACCCACAGTCAGTTACAATATTTGGGGAATCTGCAGGTGGCGGGAGTGTATCTGCACAGGTATTGTCCCCACTTTCTAAGGGGCTGTTCCACAAAGCCATTGCTGAGAGTGGAGTTGCAATAATTCCTGGTTTCATGAGCAGTAAAACCGAAGAGATCCTTCCTGTTCTATCTGTAGTTGCTAACATATCCTCCTGTAGTGTATCGGAACTGGTAGGCTGTCTCAAAAAGAAAACAGAAGATGAGATTGTTGCGATTACTGCAGCAATGAAATTTGTAATGTTCCCTGCTGTTGTCGATGGTGTGTTCCTTCCCAAACCTGCGGAGGAGATCTTAGCTGCCAAGGAGAGCAATCCAGTTCCTTTTCTGATTGGTATTAATAACCATGAATTTGGCTGGATGCTGCCAGTGGCTTTTAATCTCACTGGATACAGGGAAGGAATGGAAAAGAAAGACATTCAGGCAATACTTGGTACTCTCCCTTTGTTGAATAAGGTTCCCTTTGTTATTCCTTTCATCATGGAAGAGTACTTTGGTGACACAGATGAACCAAAAGAGTTAAGAAACAATTTCTTGGATCTAGCTGGGGACACTATATTTGTTATACCTGCTCTAAGAACAGCTAAATATCACCGAGATTCGGGGTTTCCTGTTTACTTCTATGAATTTCAGCACCGCCCTTCAATGTTTGCAGACTCAAAAGATGATTTTGTTAAAGCTGATCACGGTGATGAACTTTACTTTGTTGGTGGTGGCCCATTCCTGAAAAGTGTCCTTCTTTTCAAAAGTAATGCAACAGAGGAAGAGAAAATCCTCAGTAAAACAATAATGAAATATTGGGCTAACTTCGCTAGAAATGGGGATCCCAATGGTCTTGGTTTGGCTGAGTGGCCAAAATATGATGAAGATGAAGACTATCTGGAAATTAACTTGACACAGAAATCATCTCAAAGGTTAAAGGGAGGAAGATTGAAATTTTGGACCATCACCCTTCCTGACAAAATTAAAGAGTTGATGGAAGAAAAAGGAGAACGTGTACAGCTTTAA
Full Trace Sequence: gctctgtacgcctgctcctgttaagccgctagttttttgtattacagaaactcttgtgtgttttgcaactcagcaaagtgttttctgttccgcgctgaatttttgcaaatgggatccctgatcaaagtgcttctcttgtgctgtgcgactctggaaatctatggaacagaggatgcaagaccactattgacgacaaagtatgggcagcttcttggaaacacagttggcgcaaaggaaacagatagattagttcatgtttttatgggcgtcccctttgcaaagccacctatcggaccattaagatttgaggctccgcagccaccggagccatggagctctgtcagggaagccacagccgctccacccatgtgtttacaagataaaagaggaatggaagcccttgctaaatatttcaaggcagagtttgattttcctccagtttcagaggattgtttgtacctaaatgtcttcactccagcagacagaggagagaacccagagctccctgtcatggtgttcatacatggaggaggacttactatgggaggagcattcatgtttgaaggcactgctttatgtgcctatgaaaatgttgttgtggtgtcaatccagtatagacttggcattatgggattctttagttctggtgataaagaagtacgtgggaactttggatttctggatcaggttgcagctttacaatgggttcgtgataatattaaggattttggaggaaacccacagtcagttacaatatttggggaatctgcaggtggcgggagtgtatctgcacaggtattgtccccactttctaaggggctgttccacaaagccattgctgagagtggagttgcaataattcctggtttcatgagcagtaaaaccgaagagatccttcctgttctatctgtagttgctaacatatcctcctgtagtgtatcggaactggtaggctgtctcaaaaagaaaacagaagatgagattgttgcgattactgcagcaatgaaatttgtaatgttccctgctgttgtcgatggtgtgttccttcccaaacctgcggaggagatcttagctgccaaggagagcaatccagttccttttctgattggtattaataaccatgaatttggctggatgctgccagtggcttttaatctcactggatacagggaaggaatggaaaagaaagacattcaggcaatacttggtactctccctttgttgaataaggttccctttgttattcctttcatcatggaagagtactttggtgacacagatgaaccaaaagagttaagaaacaatttcttggatctagctggggacactatatttgttatacctgctctaagaacagctaaatatcaccgagattcggggtttcctgtttacttctatgaatttcagcaccgcccttcaatgtttgcagactcaaaagatgattttgttaaagctgatcacggtgatgaactttactttgttggtggtggcccattcctgaaaagtgtccttcttttcaaaagtaatgcaacagaggaagagaaaatcctcagtaaaacaataatgaaatattgggctaacttcgctagaaatggggatcccaatggtcttggtttggctgagtggccaaaatatgatgaagatgaagactatctggaaattaacttgacacagaaatcatctcaaaggttaaagggaggaagattgaaattttggaccatcacccttcctgacaaaattaaagagttgatggaagaaaaaggagaacgtgtacagctttaagttccattaattaggattttgtgccctgcaagtactgtggtactgctctggtatgccccattcccccagatgcatttttcccatagtaaaaccctacctaacagcactgacagaactgttataaactgagacaaactacctccctaatgagaatgttatgtaatactaatggaagagcacttattaattagaatgcattccattggcaatccacctttgttgcccttaaagtacagtcaaaacatctgttaagggagtcagttgatgtacttcgacactgagggattctaacaggaaatccgtttttaagttttgcattgccagataactttatgaaataaagtataaatgaagtttattttagctctgcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGSLIKVLLLCCATLEIYGTEDARPLLTTKYGQLLGNTVGAKETDRLVHVFMGVPFAKPPIGPLRFEAPQPPEPWSSVREATAAPPMCLQDKRGMEALAKYFKAEFDFPPVSEDCLYLNVFTPADRGENPELPVMVFIHGGGLTMGGAFMFEGTALCAYENVVVVSIQYRLGIMGFFSSGDKEVRGNFGFLDQVAALQWVRDNIKDFGGNPQSVTIFGESAGGGSVSAQVLSPLSKGLFHKAIAESGVAIIPGFMSSKTEEILPVLSVVANISSCSVSELVGCLKKKTEDEIVAITAAMKFVMFPAVVDGVFLPKPAEEILAAKESNPVPFLIGINNHEFGWMLPVAFNLTGYREGMEKKDIQAILGTLPLLNKVPFVIPFIMEEYFGDTDEPKELRNNFLDLAGDTIFVIPALRTAKYHRDSGFPVYFYEFQHRPSMFADSKDDFVKADHGDELYFVGGGPFLKSVLLFKSNATEEEKILSKTIMKYWANFARNGDPNGLGLAEWPKYDEDEDYLEINLTQKSSQRLKGGRLKFWTITLPDKIKELMEEKGERVQL
Donor tissue: