ORFeome > MGC89251 – XORFeome 2.0

MGC89251 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89251 protein, mRNA (cDNA clone MGC:89251 IMAGE:5383953), complete cds
Gene Symbol: MGC89251
Gene ID: 448372
ORF gb_acc:
ORF ID: 11402

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075456

Library Location

Plate ID: GDExt11013
Well Location: H04

EST Sequences

Clone: MGC:89251 IMAGE:5383953
Trimmed Sequence: ATGGCTGAGTGTTCCACGCTGGAGAGTCTCATTGAGATGGGATTTTCACCCAGTAGAGCAGAGAAGGCATTGGCTGCTACTGGCAATCAGGGAATAGAACCAGCTATGGACTGGTTAGTAGAACATGAAGATGATCCTGATATTGATGAACCAAGTGTGGTTGTCCCTGAAGATAGTGATTCTGGTACAACAGATACACAAGGCATGGACACCTGTGAAGAAAGACTTCCCCTGACTGAAGAGGAGAAAGAGAAACAGACAAAGAGGATGATGGAACTGATTGCCCAGAAGCAGAAAGAGCGAGAAGAAAGAGAGAAGAGGGAAAGGATTGAACAGGAAAAGCAGCGACGGAAGCAAGGTCAAGAATTGTCTGCAGTCAAGCAGAAAATACAAGAACAAGAGATGCAGAAAGCTGTTGAAGACAGAAGAAGAGAAAAACAAGAAGAGAAGCTGGCAAGGGATAGAGTCCGGGAAAAAATTGCACGAGATAAAGCTGAGAGAGCTAGAAGGTTTGGAGGAGCAGGTTCAGAACCGATCTCGCCTCCAGCAGAGGCCTCTATTCCTGCTACCACCCCATCCCCATCTTCCCCAGTACAAGAGCCGCCCACTAAGAAGGAATATGATCAGTGCCGTATTCAGGTGCGTCTGCTTGATGGATCTGCCTTATCCCAGACTTTCCGTGCTCGAGAGCAGCTAGCGGCGGTGCGTCTGTATGTGGAGCTGAACTGGCCTGGGGGTGCCCCGGGGCCTTTCAATCTCCTCACAAGCTTCCCAAGAAGAGTCTTCACAGAAGAGGACATGGAAAAGCCCTTGCAAGAACTTGGTTTGGTGCCTAGTGCAGTCCTAATTGTTGCCAGAAAATAA
Full Trace Sequence: gaaagatcaggagctacgggagcagttcgggcaatgtggggaatgtaaacaatacactgggacagccagctgccttatgttaatcgggctgtcccgtgaaaagctgccaacttgggaggtatgtttctagtgcagtatggcaatgtatgatattcggccactgtgcaggttgggaacagacacagaggggcggggctggggaggagtttcctccgctactgcaaagttctgtctgtcagtactatgactacttcctgtgaaagaatgaagcgaccccctcccccccattcctcatttcagcaaacacactgaagagaaaggatgtctatgtagctctgatctaattacatttttaggagagatggctgagtgttccacgctggagagtctcattgagatgggattttcacccagtagagcagagaaggcattggctgctactggcaatcagggaatagaaccagctatggactggttagtagaacatgaagatgatcctgatattgatgaaccaagtgtggttgtccctgaagatagtgattctggtacaacagatacacaaggcatggacacctgtgaagaaagacttcccctgactgaagaggagaaagagaaacagacaaagaggatgatggaactgattgcccagaagcagaaagagcgagaagaaagagagaagagggaaaggattgaacaggaaaagcagcgacggaagcaaggtcaagaattgtctgcagtcaagcagaaaatacaagaacaagagatgcagaaagctgttgaagacagaagaagagaaaaacaagaagagaagctggcaagggatagagtccgggaaaaaattgcacgagataaagctgagagagctagaaggtttggaggagcaggttcagaaccgatctcgcctccagcagaggcctctattcctgctaccaccccatccccatcttccccagtacaagagccgcccactaagaaggaatatgatcagtgccgtattcaggtgcgtctgcttgatggatctgccttatcccagactttccgtgctcgagagcagctagcggcggtgcgtctgtatgtggagctgaactggcctgggggtgccccggggcctttcaatctcctcacaagcttcccaagaagagtcttcacagaagaggacatggaaaagcccttgcaagaacttggtttggtgcctagtgcagtcctaattgttgccagaaaataaaaccgcacatgaattgtaaccacctgaaaacgtgaaatgcagtgtgtgctccccagaagagcacagactgtaggagaggcctctctccctggaaagacaacacacggactgttcttcacgcatctccctgaggtgtactgtagtgtgtgcgtgtgttcagagggagaaataaaccagtgtgatatgaacatccactcttctggatacacggttattctgatgtaaaatgatctgctctgctaaaagttgagtcccttctattaaataatatcaacttttacagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAECSTLESLIEMGFSPSRAEKALAATGNQGIEPAMDWLVEHEDDPDIDEPSVVVPEDSDSGTTDTQGMDTCEERLPLTEEEKEKQTKRMMELIAQKQKEREEREKRERIEQEKQRRKQGQELSAVKQKIQEQEMQKAVEDRRREKQEEKLARDRVREKIARDKAERARRFGGAGSEPISPPAEASIPATTPSPSSPVQEPPTKKEYDQCRIQVRLLDGSALSQTFRAREQLAAVRLYVELNWPGGAPGPFNLLTSFPRRVFTEEDMEKPLQELGLVPSAVLIVARK
Donor tissue: neurula