ORFeome > MGC89537 – XORFeome 2.0

MGC89537 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89537 protein, mRNA (cDNA clone MGC:89537 IMAGE:6993217), complete cds
Gene Symbol: MGC89537
Gene ID: 448461
ORF gb_acc: MG133986
ORF ID: 11584

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075570

Library Location

Plate ID: GDExt11015
Well Location: B06

EST Sequences

Clone: MGC:89537 IMAGE:6993217
Trimmed Sequence: ATGGCTCTCCCGTCAGAACATGGCTGTGTCAATGGCTCTCTACTTGCATTAAGTTGCCCATCACGCCAGGTGCTGTGCCAGATCGTGGGGGACATTGACCTCTCCATATCCATCTATCAGAACCTGACGCTGGCCACTGGCTTGTTGCCCACCGTAACTCAAAACTATGACTTCCTTATTGGTTTGCTGTTGGCTGTGCTGTCCAGCCTCCTTATTGGCAGCAGCGTCATCCTCAAAAAGAAAGGGCTCCTCCGCCTGTGTCGCCACGGTGGGACTCGTGCAGGTGCTGGTGGACATGGGTATCTGAAAGACTGGATGTGGTGGGCTGGACTATTAACAATGGGAGGAGGCGAAGCTGCCAATTTTGCTGCTTATGCATTTGCACCGGCCACCATTGTCACTCCCCTGGGGGCGCTCAGTGTCCTAATCAGCGCTGTGCTGTCCTCTTACCTGCTCGGAGAGCGCCTGAATCTCTTAGGGAAGCTGGGCTGTACCCTCAGTGTCCTAGGAAGCACTGTCATGGTCATCCATGCCCCTGAGGAGCAAGCGGTTACCACCTTAGCAGACATGACCCTCAAACTGCAGGATCCAGGTTTCATAGCTTATATCAGTCTCATGCTGGTCTGCTGTTTGGTTTTGATCTTCCTCCTTTCCCCTCGTTATGGCCACACCAACATCCTTATCTACCTGGCTATCTGCTCGCTTTTGGGTGCCTTCTCAGTGTCTTCGGTGAAAGGTTTGGGAATTGCAGTAAAGGGCCTGATCATTGGACAGCCTGTTATCACACACCCTCTGCCCTGGATCCTTATACCTATCTTGATCTTATCGGTTATTACCCAAGTCAACTACCTTAACAAGTCTTTGGACGTATTCAACACCTCCTTAGTTTTCCCTATCTACTATGTGCTGTTCACAAGTGTGGTTATAGCTACCTCCCTTATCCTCTTCAAGGAATGGGTGTCCATGTCTGCACTGGATGGAGTTGGAGCAGTCTGCGGCTTTCTCATCATCATTATGGGGGTCTTCATGTTGCACGCTTTTAAGGACCTAGACCTCAGTCTGCAAAGTCTTCAGCAACAACTACAGACACGTCCCCCATTACCTCCTCTCCGCTTCTCCTCAAAGGAGGACAAGATTACGTTGATAGACAATATGGAGATAGAGTCCATAGACAGCAAACCCAAGGTCTTCGTCATTTACACTTGA
Full Trace Sequence: ctatttgataacaggactgcttgcccagtcacatggctctcccgtcagaacatggctgtgtcaatggctctctacttgcattaagttgcccatcacgccaggtgctgtgccagatcgtgggggacattgacctctccatatccatctatcagaacctgacgctggccactggcttgttgcccaccgtaactcaaaactatgacttccttattggtttgctgttggctgtgctgtccagcctccttattggcagcagcgtcatcctcaaaaagaaagggctcctccgcctgtgtcgccacggtgggactcgtgcaggtgctggtggacatgggtatctgaaagactggatgtggtgggctggactattaacaatgggaggaggcgaagctgccaattttgctgcttatgcatttgcaccggccaccattgtcactcccctgggggcgctcagtgtcctaatcagcgctgtgctgtcctcttacctgctcggagagcgcctgaatctcttagggaagctgggctgtaccctcagtgtcctaggaagcactgtcatggtcatccatgcccctgaggagcaagcggttaccaccttagcagacatgaccctcaaactgcaggatccaggtttcatagcttatatcagtctcatgctggtctgctgtttggttttgatcttcctcctttcccctcgttatggccacaccaacatccttatctacctggctatctgctcgcttttgggtgccttctcagtgtcttcggtgaaaggtttgggaattgcagtaaagggcctgatcattggacagcctgttatcacacaccctctgccctggatccttatacctatcttgatcttatcggttattacccaagtcaactaccttaacaagtctttggacgtattcaacacctccttagttttccctatctactatgtgctgttcacaagtgtggttatagctacctcccttatcctcttcaaggaatgggtgtccatgtctgcactggatggagttggagcagtctgcggctttctcatcatcattatgggggtcttcatgttgcacgcttttaaggacctagacctcagtctgcaaagtcttcagcaacaactacagacacgtcccccattacctcctctccgcttctcctcaaaggaggacaagattacgttgatagacaatatggagatagagtccatagacagcaaacccaaggtcttcgtcatttacacttgagaccggccaaaatatttaggccttcaaagctgatggctttcattttcaaagcaagtatatgtacagaactgtgttggaataacaaatgtattctgtttggtcatgaaaagctcacaaagaagactcttgtagcccccctctttttcaaatcctatattggagaccaattggacagtctcctcccacatatggatgccttgatttgctatgagtgacattattatgccaggagcaattgtaaatatatatagttgtttattgagaccatttcagaggaaatattctatattgtggctctcaaatcccacagtgtaggcatctccaatgggtattagtggatcagtatctcaatgaacattctcttgctaggaatgaacgttacttgatataaaatgaatgggcataaaatgttatgattctcagcaggagagctgcaattatatgtataatgttttatgtccagctggtcggggtattcggcctctagtttttccactcctccatccatgctaaatgtttgtttcagccagaaaaatctagagcctgccatttccttgtgccccggttgctagtattttgtcatcttttcattttcatatcccaatattttgttctgtatagtttttatttttatatatttttttgctgtctaatgactaatctatttttaaagcactgttcttttgtaagttataaaagttccccttttttaaaaaaaaaaaaaaaaaaaaaaa
Translation: MALPSEHGCVNGSLLALSCPSRQVLCQIVGDIDLSISIYQNLTLATGLLPTVTQNYDFLIGLLLAVLSSLLIGSSVILKKKGLLRLCRHGGTRAGAGGHGYLKDWMWWAGLLTMGGGEAANFAAYAFAPATIVTPLGALSVLISAVLSSYLLGERLNLLGKLGCTLSVLGSTVMVIHAPEEQAVTTLADMTLKLQDPGFIAYISLMLVCCLVLIFLLSPRYGHTNILIYLAICSLLGAFSVSSVKGLGIAVKGLIIGQPVITHPLPWILIPILILSVITQVNYLNKSLDVFNTSLVFPIYYVLFTSVVIATSLILFKEWVSMSALDGVGAVCGFLIIIMGVFMLHAFKDLDLSLQSLQQQLQTRPPLPPLRFSSKEDKITLIDNMEIESIDSKPKVFVIYT
Donor tissue: neurula