ORFeome > MGC89563 – XORFeome 2.0

MGC89563 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89563 protein, mRNA (cDNA clone MGC:89563 IMAGE:6993885), complete cds
Gene Symbol: MGC89563
Gene ID: 448468
ORF gb_acc: MG133950
ORF ID: 11546

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075581

Library Location

Plate ID: GDExt11015
Well Location: G03

EST Sequences

Clone: MGC:89563 IMAGE:6993885
Trimmed Sequence: ATGGAGGAGGTGGATCGCATCCTCATTCACTCTCTGCGCTCCTGTGGCACCGAGGTACCAGAGGACGTACAGAGCATCCGTCAGTTCAACACAGAGCTTATTGTGGAGGCAGTGGTGAGATGTCTGCGCGTGATCAACCCCTCTCTGGGTGCCACCCTCAGCCATGTTCTACCCCCAGGCATGTCTGCCCGTTTCCGCATTGGCACCAGCTTGGCCCAGGCCTGCCAGGATCTGGGGTATCCAGGAGAAGTGGGGTACCAGACATTCCTATACAGTAGCGAGCCTGATATCCGAGCACTTCTCATCTTCCTGGCTGAGAAACTCCCAAGGGACTCCCCCGAGGATGCCCACCAGCCTGCAGGTAAATCTGCACTTCTTCAAAGAGAGATTGCAGCCACCATAAAACGGCAGCTCTCTCTCCCCTGGCTTCCCTCATCGTGCCGAATCTGTGCTCTCCGGAGGTCTCAGAATTCCTGTCGCTTGCACAGATTTCACGCTCAGCCCCTGTCGTTAGCCACTGACCCTACCCTGAAATCCATCCCAGACGAAAGGAAGGAGTACTGGCAGTGCTACCTGCCCTCTGTCACTTCACAGTTGCCTCATTTGCCCTCTGTTGCTGCTTCCCTGCTGGAAAGGAACACGTCCGAACTCAGCGCCAAGCAGGAGTGGGATGCTGAGTGGAAGAGTCAAGGTCTGGCTTCTCGCTTGTCCCCAGAGGATTACCGGAGCAGGAAACGGCAGCGGCTGCAGAAGCGTATACAGGAGCAGCTCCGGCAGTGCGCCCAACTTCTCGCTGAAAATCATTTGCCGTCCAGCTCTTCACAGGATCTTACCGACATGCTGAAGGCGTTCAACCTGGATGGAGGCTCTGACCAGAAGAAGGGGTCCAGATTCACTCGCACCCAGAGGTTCACTTACCAACAGGATCCTCACACTCTAAAGGAACAGATGCAGAGAGCAGCTGAGATTCTCCCCAAGAAAGATGCCCAGGACACAGATGCCGAGCAGCAGGAGCTCTCATCCTTGCAGGAGCAGATTGACTCCATAGAACAGGAAATCCGAGGGCTGAGCGAGAGCAACAAGCGCCTGCAGCTGACTGTGAGCCAGGTGGAGGGAGAGGTGAATGAGATGCGCCAGAGCTGCGAGGAGAAAGAGAAAATCGTCAGGGTAAAGAAGCGAGCGGTGGAGCTGCTCCCAGACGCAGACAACAACCTTGTCAAGTTACAGGCCTTGGTGGATGCCAGTTCTCATAGGATGGCGAATCTTGTAGGGCAGTGGGAGTCTCATCAAGTTCGGCTCAGTGAGGAATACAGGGAGCTGAAGCGAGTTCAACAGGAGCAGGAGGATGAGTCGTCGCGGTGGATGAAAGATGCCAAGGATTTGTACGAGAAGATTCGGGGAGCGGCTGATGAGGCGAAACGCAAGGAGGAGCTTTACAAGCAGCTGCTGTCAGAATACGAGTCTCTCCCAAAGGAGGTGTCCCGAGCCGCCTACACCCAACGTATCCTGGAAATTGTGAGCAATATCAAGAAGCAAAAAGAGGAAATCACTAAGATCCTGTCGGACACTAAAGAATTGCAGAAAGAGATCAACAACCTGACGGGCAAGGTGGACAGGACCTTTGTTGTCACAGACGAGCTTGTCTTTAAGGATGCCAAGAAAGATGAGCCTGTCAGAAAGGCGTATAAATACCTGGCGGCACTCCACGAGAACTGTAGTCAGCTGATCCAAACCATTGAGGATACTGGGACCATCCTAAGAGAAATTCGTGACCTAGAGGAACAGATAGAGACAGAAACCACCAAGAAGACTTGA
Full Trace Sequence: gctggagtgtaacagggcgggcacagtcagggtcctacacagagccaaacgcactctcaccccacacatacatgcatttagatacacggccgggggataaacaagcggcggtgccgactggactatggaggaggtggatcgcatcctcattcactctctgcgctcctgtggcaccgaggtaccagaggacgtacagagcatccgtcagttcaacacagagcttattgtggaggcagtggtgagatgtctgcgcgtgatcaacccctctctgggtgccaccctcagccatgttctacccccaggcatgtctgcccgtttccgcattggcaccagcttggcccaggcctgccaggatctggggtatccaggagaagtggggtaccagacattcctatacagtagcgagcctgatatccgagcacttctcatcttcctggctgagaaactcccaagggactcccccgaggatgcccaccagcctgcaggtaaatctgcacttcttcaaagagagattgcagccaccataaaacggcagctctctctcccctggcttccctcatcgtgccgaatctgtgctctccggaggtctcagaattcctgtcgcttgcacagatttcacgctcagcccctgtcgttagccactgaccctaccctgaaatccatcccagacgaaaggaaggagtactggcagtgctacctgccctctgtcacttcacagttgcctcatttgccctctgttgctgcttccctgctggaaaggaacacgtccgaactcagcgccaagcaggagtgggatgctgagtggaagagtcaaggtctggcttctcgcttgtccccagaggattaccggagcaggaaacggcagcggctgcagaagcgtatacaggagcagctccggcagtgcgcccaacttctcgctgaaaatcatttgccgtccagctcttcacaggatcttaccgacatgctgaaggcgttcaacctggatggaggctctgaccagaagaaggggtccagattcactcgcacccagaggttcacttaccaacaggatcctcacactctaaaggaacagatgcagagagcagctgagattctccccaagaaagatgcccaggacacagatgccgagcagcaggagctctcatccttgcaggagcagattgactccatagaacaggaaatccgagggctgagcgagagcaacaagcgcctgcagctgactgtgagccaggtggagggagaggtgaatgagatgcgccagagctgcgaggagaaagagaaaatcgtcagggtaaagaagcgagcggtggagctgctcccagacgcagacaacaaccttgtcaagttacaggccttggtggatgccagttctcataggatggcgaatcttgtagggcagtgggagtctcatcaagttcggctcagtgaggaatacagggagctgaagcgagttcaacaggagcaggaggatgagtcgtcgcggtggatgaaagatgccaaggatttgtacgagaagattcggggagcggctgatgaggcgaaacgcaaggaggagctttacaagcagctgctgtcagaatacgagtctctcccaaaggaggtgtcccgagccgcctacacccaacgtatcctggaaattgtgagcaatatcaagaagcaaaaagaggaaatcactaagatcctgtcggacactaaagaattgcagaaagagatcaacaacctgacgggcaaggtggacaggacctttgttgtcacagacgagcttgtctttaaggatgccaagaaagatgagcctgtcagaaaggcgtataaatacctggcggcactccacgagaactgtagtcagctgatccaaaccattgaggatactgggaccatcctaagagaaattcgtgacctagaggaacagatagagacagaaaccaccaagaagacttgagtaatctacagaagatcctggaagattatagggccattaaacaggagaatgctcagctactggcccgaatcagggaggcttaatgttgcgcagcccataataatgccccctcaccccatcagttatacttgtaacacaaatcagccatcatttccctcactaaataatagccacctaccaaacagaggatcatttcacctgtttttctaccttaaacaaagcggccaaaataatgtgagctcctatgcgattagagcatttttgtaatgtttcaggaactctaaggagctataatgttagtttaataatatgaaatcattataataaacacatgctataaaatctaaaaaaaaaaaaaaaaaaaaa
Translation: MEEVDRILIHSLRSCGTEVPEDVQSIRQFNTELIVEAVVRCLRVINPSLGATLSHVLPPGMSARFRIGTSLAQACQDLGYPGEVGYQTFLYSSEPDIRALLIFLAEKLPRDSPEDAHQPAGKSALLQREIAATIKRQLSLPWLPSSCRICALRRSQNSCRLHRFHAQPLSLATDPTLKSIPDERKEYWQCYLPSVTSQLPHLPSVAASLLERNTSELSAKQEWDAEWKSQGLASRLSPEDYRSRKRQRLQKRIQEQLRQCAQLLAENHLPSSSSQDLTDMLKAFNLDGGSDQKKGSRFTRTQRFTYQQDPHTLKEQMQRAAEILPKKDAQDTDAEQQELSSLQEQIDSIEQEIRGLSESNKRLQLTVSQVEGEVNEMRQSCEEKEKIVRVKKRAVELLPDADNNLVKLQALVDASSHRMANLVGQWESHQVRLSEEYRELKRVQQEQEDESSRWMKDAKDLYEKIRGAADEAKRKEELYKQLLSEYESLPKEVSRAAYTQRILEIVSNIKKQKEEITKILSDTKELQKEINNLTGKVDRTFVVTDELVFKDAKKDEPVRKAYKYLAALHENCSQLIQTIEDTGTILREIRDLEEQIETETTKKT
Donor tissue: neurula