ORFeome > MGC89575 – XORFeome 2.0

MGC89575 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89575 protein, mRNA (cDNA clone MGC:89575 IMAGE:6994102), complete cds
Gene Symbol: MGC89575
Gene ID: 448471
ORF gb_acc: MG133926
ORF ID: 11519

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075585

Library Location

Plate ID: GDExt11015
Well Location: B12

EST Sequences

Clone: MGC:89575 IMAGE:6994102
Trimmed Sequence: ATGGATCAAGGTGGAATCATCGCACCCGAAACCCGGCCGAGCCCCTGGGGTGTTGCTGCAAAGCCTGCAGTTCAGTGCTCCCTGGCGGAGGTCATGAGTGAGGAGCTGGCAAGGGAACTCCAACTGGAAGAAGAGAGCCATGTTTTCCCAGAGGAGGTTCTTAGCGAAGATGGTCCTTTCCTGAGTTCTGATAACATTGACACATCAAGCGATGAAGTCTTGGCTCAGATGCTGCAGATGCAGTTTGACAAGGAATATGATGCCCAGCTTCTGAGAGAAGAGAAAAAGTTTAATGGTGACAGCAAGGTATCCATATCGTTTGAGAACTATCGGAAAGTTCATCCCAGTGAAGAAAATGACAGCTCAGAGGATGAAGTGGACTGGCAAGACACTCGCCATGATCCATACAAAGCAGATAAACCAACGCCTACCCCTAAAAAAGGCTTTGTTGGCAAGGGGAAAGACATTACAACTAAACATGATGAGGTAGTGTGCGGCAGGAAGAACACGGCACGAATGGAAAATTTTGCCCCAGAATTCCAGGTTGGAGATGGAATTGTCATGGACCTGAAGTTGTCCAACCAAGTTTTCAATGCTTTGAAGCAGCATTCTATTTCTGAGCAGCGTAAAAGTGCCAGATTGCATGATAAAAAGGAAGTTTCTACTGCTGAAAAAGTAGTGGATCCCAAAACTAGACTGCTGTTATATAAAATGGTGAACTCTGGTGTGCTGGAAACTATTAATGGCTGTGTGAGCACTGGAAAGGAGTCTGTTGTGTTTCATGCTAGTGGAGGAAGTATGGAGGATCAAGAAATACCTGCTGAATGTGCTATAAAAGTCTTCAAAACAACGCTAAATGAGTTTAAGAACAGAGATAAATACATCAAGGACGATTACAGATTCAAAGAACGTTTCAGTAAACTTAATCCACGCAAGATAATTCGGATGTGGGCAGAAAAGGAAATGCACAATTTGAAAAGAATGCACAAAGCTGGCATTCCATGCCCAGAAGTCGTCTTGTTGAAGAAACACGTTCTGGTGATGTCATTTATCGGAAATGATCAAATCCCTGCCCCTACACTGAAGGAAGCCAAACTTGGTTTGGAAGATTCAAAGCAGGCATATTATCAAGTGCTTTCTATGATGAAGCAGCTCTATGAGCAGTGTAACCTCGTTCATGCTGATCTCAGTGAATATAACATGATGTGGCACGATGGAAAGGTGTGGCTTATAGATGTAAGTCAGTCTGTTGAACCTACTCACCCCCATGGCCTGGAATTTCTGTACAGGGACTGCAGGAATGTGTCCCAGTTCTTCCAGAAAGCTGGTGTGTCAGAGACTCCTCATGCACGGGAACTTTTCAACATAGTGTCTGGCTTGAATATTTCCTCTGATAACCAAGTGGACTTTATGGCTGAGATTGAAGCATTGGAGAAGGTGAATGAGGATCACGTGCAGATGCATGGAAAGAAAGTTTCCATATATCAGAAAGATGATGATGGTCCTCCCCGAATTTATGACAAATAA
Full Trace Sequence: gagagcaggttctcaggagctggtgctgattcttcttaactgtcactcgcagcctaaccttccgcttttcattataaaatataggtagctgtattattaatatcaagactagtgtagctctgcgagaattaactttctttttcagtgtcagccgcactgagacaagtccgggcacgttccgaggcgacacagacctcatatagtcatagtgacagtctgctccgagctcctcctcctctacttactgagcccgacattctctcccccggcacccatactaggctgaatgagaagatggatcaaggtggaatcatcgcacccgaaacccggccgagcccctggggtgttgctgcaaagcctgcagttcagtgctccctggcggaggtcatgagtgaggagctggcaagggaactccaactggaagaagagagccatgttttcccagaggaggttcttagcgaagatggtcctttcctgagttctgataacattgacacatcaagcgatgaagtcttggctcagatgctgcagatgcagtttgacaaggaatatgatgcccagcttctgagagaagagaaaaagtttaatggtgacagcaaggtatccatatcgtttgagaactatcggaaagttcatcccagtgaagaaaatgacagctcagaggatgaagtggactggcaagacactcgccatgatccatacaaagcagataaaccaacgcctacccctaaaaaaggctttgttggcaaggggaaagacattacaactaaacatgatgaggtagtgtgcggcaggaagaacacggcacgaatggaaaattttgccccagaattccaggttggagatggaattgtcatggacctgaagttgtccaaccaagttttcaatgctttgaagcagcattctatttctgagcagcgtaaaagtgccagattgcatgataaaaaggaagtttctactgctgaaaaagtagtggatcccaaaactagactgctgttatataaaatggtgaactctggtgtgctggaaactattaatggctgtgtgagcactggaaaggagtctgttgtgtttcatgctagtggaggaagtatggaggatcaagaaatacctgctgaatgtgctataaaagtcttcaaaacaacgctaaatgagtttaagaacagagataaatacatcaaggacgattacagattcaaagaacgtttcagtaaacttaatccacgcaagataattcggatgtgggcagaaaaggaaatgcacaatttgaaaagaatgcacaaagctggcattccatgcccagaagtcgtcttgttgaagaaacacgttctggtgatgtcatttatcggaaatgatcaaatccctgcccctacactgaaggaagccaaacttggtttggaagattcaaagcaggcatattatcaagtgctttctatgatgaagcagctctatgagcagtgtaacctcgttcatgctgatctcagtgaatataacatgatgtggcacgatggaaaggtgtggcttatagatgtaagtcagtctgttgaacctactcacccccatggcctggaatttctgtacagggactgcaggaatgtgtcccagttcttccagaaagctggtgtgtcagagactcctcatgcacgggaacttttcaacatagtgtctggcttgaatatttcctctgataaccaagtggactttatggctgagattgaagcattggagaaggtgaatgaggatcacgtgcagatgcatggaaagaaagtttccatatatcagaaagatgatgatggtcctccccgaatttatgacaaataaccctgacggtataaatgagctaacagttaataaaaaaagaggataaaggcttgctgcattcttacacactgatgcggcggttattcccctccagcacagcgtagattggaagctgtgaatcagaacacacaaagcgccctgcaggtcactctgcattccctctgaggcgcctgacacagctgggattgtactgagcatacactgcaatgaaatgccatcaattttaatgtacttctataaggaacaaaaaaaaaaagagatgttttgatagagattactaattatagtaatgtcttgttttgcttctgcttctttgagcactaagaggattatttcattaggtatcagacattttgtttaattgccctgtttgatccaaagggctttaagaaaatagtgtgcacgtgtggttaaaaagaaatcttaccctgtttcatagtctgcctaaaacagccaactccatcaatgctgatttagaactaaagaagataaaattctgtgctgaaagtctgatataattaaagttttcctggcagcagaaacattatcataaccaaagttggtgtctttttttttccttaattgttcttaactaaagcagttttgagtgtatcaaacttattaatacattgccctgttagtcaaggctcagcatatataatgaattgttcagtttctttctagtctataatccagcagtgctaaatctgaacataactggtttactaattaaagctagacatttttggctgtaaataaatgagggaggaggatctctggtgcttaatgcaatgcaaatatacattatactctctgatgtcctcatgtagaaattgtaactggttatattatgtcagatttacatgcttaattgtttgaagtgataatagtataatatgcaagtacttgttctgtggttatgacaccaatttcttagaggtaaataataaaggcttactgaattgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDQGGIIAPETRPSPWGVAAKPAVQCSLAEVMSEELARELQLEEESHVFPEEVLSEDGPFLSSDNIDTSSDEVLAQMLQMQFDKEYDAQLLREEKKFNGDSKVSISFENYRKVHPSEENDSSEDEVDWQDTRHDPYKADKPTPTPKKGFVGKGKDITTKHDEVVCGRKNTARMENFAPEFQVGDGIVMDLKLSNQVFNALKQHSISEQRKSARLHDKKEVSTAEKVVDPKTRLLLYKMVNSGVLETINGCVSTGKESVVFHASGGSMEDQEIPAECAIKVFKTTLNEFKNRDKYIKDDYRFKERFSKLNPRKIIRMWAEKEMHNLKRMHKAGIPCPEVVLLKKHVLVMSFIGNDQIPAPTLKEAKLGLEDSKQAYYQVLSMMKQLYEQCNLVHADLSEYNMMWHDGKVWLIDVSQSVEPTHPHGLEFLYRDCRNVSQFFQKAGVSETPHARELFNIVSGLNISSDNQVDFMAEIEALEKVNEDHVQMHGKKVSIYQKDDDGPPRIYDK
Donor tissue: neurula