ORFeome > MGC89818 – XORFeome 2.0

MGC89818 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89818 protein, mRNA (cDNA clone MGC:89818 IMAGE:7028427), complete cds
Gene Symbol: MGC89818
Gene ID: 493338
ORF gb_acc: MG133174
ORF ID: 10630

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080480

Library Location

Plate ID: GDExt11006
Well Location: G05

EST Sequences

Clone: MGC:89818 IMAGE:7028427
Full Trace Sequence: ggcagacactctggttgttgtctctatgttggctgtactctctcttccccgtagtcttgttcctctggagtcccggaagtaagtgagaagcggaatggcggaaagtccagcggctgaagcgattatcctcccaggagctgcggcgggtgggggtgtccttcctcatctgagcgggctccaagcgcctgggacatctcctctgacaacctcctcggtgtgggacccgacagccagcgccgactgggataacgagagggcatctaatcagtgcgtgctgcggataaagagggatattatgtccatttataaagagccgccccctggtatgtttgtggtgccagatcctcatgacatgacaaagatccatgcactcatcacaggcccgtttgatacaccttatgaaggtggtttcttcttgttcctgttccggtgtcccccagactacccaatacacccacctcgggttaaattgatgacaacagggaataatactgtgagatttaaccccaatttctaccgcaatggcaaagtctgcctgagtattctaggaacttggacaggacctgcatggagtccagctcagagtctctcttcagtgctcatatcaatccagtctcttatgaccgagaatccctatcacaacgaacccggctttgagcaggagagacactctggcgatagcaagaactacaatgagtgcattcgacacgagaccattcgggtagcagtgtgtgagatgctggagggcaagtgccagtgccctgatgcattaaggagtgttatggagaaatcatttatggaatattatgacttttatgaagcagtttgcaaagatagatttcacctacaagggcaaaacatgcaggatccatttggtgagaagcgaggccactttgattatcagtctttgctgagccgccttcagaccattcaccagcgagtgagggagaagcaccggaaagagactgtggatatagactctgattcgagctcctcagagacagaaactgacacacagggaagctcaaatccttaagtggatgggaatgtaactgtgtagcgcttggtgtgtcgtcacttcagactgttatgttagccgagtatcatggattgtgtttgacaagaaaggaccttgctgacacctcgcctctttgccttggatgctgtatggatgcagtgtcaagtaatcactctaattactaaggagcaaatgggaaaagcttttatggaatggattccgaatcatggagcgtttggatttctcgccagggcagcactttgttacaatgtatgattttctctcctctttgcagaatagtcatgtattggtcccgatgagccaaagagtcttgacaataggagagcagaattcagccacgtgatctcaagcacatgagaaatgccattttttatttttcagatttgacagaagccactactttttaattgttttgttttttgtttttttttgttcaccccacaaagaaatgcactttgtcttttgccttctgggctttgtctgtgtagatgttgtacatatgtttgctaggggaataaaccaaggcttcttagataagttcttagcaccccccacccactaatatcagggtcccttaataggtgttaatttatgaagagcaaatataatctgtaaatacaaaaaaaaa
Donor tissue: