ORFeome > MGC97528 – XORFeome 2.0

MGC97528 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC97528 protein, mRNA (cDNA clone MGC:97528 IMAGE:5382658), complete cds
Gene Symbol: MGC97528
Gene ID: 548524
ORF gb_acc: MG134389
ORF ID: 12079

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090085

Library Location

Plate ID: GDExt11020
Well Location: E03

EST Sequences

Clone: MGC:97528 IMAGE:5382658
Trimmed Sequence: ATGGAGAACAACGGGGGATTATGGGAAAGGCGGGAGAACCCGGGGCGCCTGCAGGCTCGGGAGCACTGCCCCGGGGTAAATAACCGACCGTATGTGTGTGAGACCGGCCACTGCTGCGGGGAGACCGGCTGCTGCACTTACTACTATGAGCTGTGGTGGTTCTGGCTTCTATGGAGTGTCCTGATCCTTCTGAGCTGTTGCTGCGCCTACCGACACCGCCGCGCCAAACTGCGCCTGCAGCACCAGCAGCGACAGCGGGAGATCAACCTGATCGCTTACCAACGTGCCTGTCACTATCCCCCCTCCAGCCTGGATCTCAGGGTGTTGGCACCTTTTAAACTTCCGGCTTATGAGGAGGTTGCGTGCCGTCCCACAACCCCTCCCCCTCCATACAGCTCCATCCTCAACCCATTTGGACCACCATGCTCCCCACCGCCATCACTGGAGGACACTGCCTCCCCCAGTACAGAGCCCTCCAGCTGCTGCTCCTGTACCTCAGACTGCGTGACCTCGGCCAGCAGCTCCTCCTTCACTGTGCAGGTCACAGATGAGACGGCCGCTAGCCAGGGGAGTACGGCCAGTGAGGGGGGCAGTTGGGAGGAGAGTCTGGAGGAGGAGGAGGAGCAGCTGGGGGCCTATGGAAGGGAGGCTGCCTTCTCTTCATACGCAGACTTGTTTGAGGGAGGCAGCCGTATCTGCTGGGCCATTGAGGAAGAGGAGGAGGAGGATGACGAGGAAGAGCATTACAGACACCGCAGGCTGACAGGGGACTCGGGCATAGAGGTTTGCCGCTGCCACATTGTGGGAGAGGAAGATGAGGAAAGGAGCGATGGGCACGACAGCCCAGGCTGCACAGAGAGGAGTAAAGCAGGGGCTGGGGGGCCTCCATCTGAGAAGGGAGAGGCGGAGCCAGACTCACCCATCCAGCCTGTGTGA
Full Trace Sequence: gccggtggtgcggccctgggagaggagcggctcaagggcgtcctgagaggatggagaacaacgggggattatgggaaaggcgggagaacccggggcgcctgcaggctcgggagcactgccccggggtaaataaccgaccgtatgtgtgtgagaccggccactgctgcggggagaccggctgctgcacttactactatgagctgtggtggttctggcttctatggagtgtcctgatccttctgagctgttgctgcgcctaccgacaccgccgcgccaaactgcgcctgcagcaccagcagcgacagcgggagatcaacctgatcgcttaccaacgtgcctgtcactatcccccctccagcctggatctcagggtgttggcaccttttaaacttccggcttatgaggaggttgcgtgccgtcccacaacccctccccctccatacagctccatcctcaacccatttggaccaccatgctccccaccgccatcactggaggacactgcctcccccagtacagagccctccagctgctgctcctgtacctcagactgcgtgacctcggccagcagctcctccttcactgtgcaggtcacagatgagacggccgctagccaggggagtacggccagtgaggggggcagttgggaggagagtctggaggaggaggaggagcagctgggggcctatggaagggaggctgccttctcttcatacgcagacttgtttgagggaggcagccgtatctgctgggccattgaggaagaggaggaggaggatgacgaggaagagcattacagacaccgcaggctgacaggggactcgggcatagaggtttgccgctgccacattgtgggagaggaagatgaggaaaggagcgatgggcacgacagcccaggctgcacagagaggagtaaagcaggggctggggggcctccatctgagaagggagaggcggagccagactcacccatccagcctgtgtgaacagaactgtaggaaggaggaggagcccagcttgggtgggagcagagacatcggggtgcaaatgtctatgcactgaggggagggcaatatttagtatttagccacgtctcctctctgtgactgtctctctctctgtaagggaaatgggtgagtagggtgcccctaaggggtgacaataatatggagccatagtcctgcgcagtctgtctctcgtgccagagatgatagagacttgggtccgtggagtcctgagttgccaaagaaaacagaaccatagacgtgtgggcacactggcagaaccatcaatcccccgtgttgctccatcttggggtggggggatctttagatctagaggggtccatttctcactgccagtggtgaggctgggagcaataggagctctgtgggcccatctggcggggacctgtgtcacaccaaataaatgccatccaaggtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MENNGGLWERRENPGRLQAREHCPGVNNRPYVCETGHCCGETGCCTYYYELWWFWLLWSVLILLSCCCAYRHRRAKLRLQHQQRQREINLIAYQRACHYPPSSLDLRVLAPFKLPAYEEVACRPTTPPPPYSSILNPFGPPCSPPPSLEDTASPSTEPSSCCSCTSDCVTSASSSSFTVQVTDETAASQGSTASEGGSWEESLEEEEEQLGAYGREAAFSSYADLFEGGSRICWAIEEEEEEDDEEEHYRHRRLTGDSGIEVCRCHIVGEEDEERSDGHDSPGCTERSKAGAGGPPSEKGEAEPDSPIQPV
Donor tissue: neurula