ORFeome > MGC97549 – XORFeome 2.0

MGC97549 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC97549 protein, mRNA (cDNA clone MGC:97549 IMAGE:5383970), complete cds
Gene Symbol: MGC97549
Gene ID: 595021
ORF gb_acc: MG134469
ORF ID: 12174

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC091589

Library Location

Plate ID: GDExt11021
Well Location: D02

EST Sequences

Clone: MGC:97549 IMAGE:5383970
Trimmed Sequence: ATGGCTGGTGGCATCATGGCAACTTTGCACCCTTCATTGCTCACAACCCTACCGCTGCCAAAGAATCTAACTAATAACACAGAGGACAGTTGTGTTTTCAATGAGGGATTCAAGTTTTTGCTGCTGCCTATCTCCTACAGTGGAGTGTTTATGGTGGGCCTGCCTCTAAACATAACAGCTATATGGATATTCATTGCCAAAATGCGACCATGGAACCCCACAACAGTTTATATGTTTAACCTTGCACTGTCTGACACACTGTATGTTCTGTCTCTACCCACTCTGGTCTATTACTATGCTGACCAAAACAACTGGCCCTTTGGGGTAGCTCTCTGCAAGATTGTAAGATTCCTTTTTTATGCCAACCTCTATTCCAGCATTCTGTTCCTCACCTGCATCAGTGTGCACCGCTACCGGGGGGTGTGCCACCCTATAACCACTCTGAGGTGTATGAATGCTAAACATGCCCATGTGATCTGTGCACTGGTATGGCTATCAGTTATGCTCTGCCTTGTGCCCAATTTAATGTTTGTCACAGTCAGTCCAAAGGTTAATGGCACAATTTGTCATGATACCACACTTCCTGAAGAATTTGACAAATATGTGGAGTACAGTACTGGAATTATGTGCCTACTCTTTGGGATACCGTGCCTCATAATTGCATGCTGCTATGGACTCATGGCAAGAGAACTAATGAAACCACTTGTCAATGGGAACCATCAGACTCTACCATCATACAAAAAGAGATCCATTAAGACCATTGTCATTGTTATGATAGCATTTGCTATTTGCTTCATGCCTTTTCACATCACTCGAACCCTGTATTATTATGCCCGTCTGCTAGGTGTCAATTGTTATGCACTCAATGTGATAAATTTCACATACAAGATTACACGCCCTTTAGCCAGTGCCAACAGTTGCATTGACCCAATACTCTACTTTCTGGCCAATGACAGGTATAGACGTAGGCTGATAAGGACAGTGAGAAGAAGTTCAGTTCATCACAGGAGGTGTATGCATACAAACCACCCAGGGCCCCATCCAGAGCCTGAGCCCCATATGACAACAGGACCTTTACCTGTGGTTTCTGCTGAGGAGACACAGAGCAATGGCAGAATGGTGAGAGATGAGAATGAAGAAGGTGCCAGAGAGCACAGGGTTGGATGGACAGCCAGCAAAGACTCAAAGCAAAGGAAGAGTGTGTATCATCAAAGCACAATCAAGAGAAACTCTATGGACAAAAACAATATGAAAGAACACAGACATGGGGAAAACTATCTTCCCCATGTAGAGGTAGTTGAAAAGGAAGATTATGTGACAGAAGGAGAGAACAGAAAAACAACTGGACAGGGAGATATTGCAGAGAGCAGGAAAACCAATGATGAACAGGATGAGATTCAGACACAAATTAGCAGCAGTCTTAAAAAAGGAAAATGGAGACTGTCCTCAAAGAAGGGTGCAACACAGGAATATGAAGAAGGCCATGTGGAATCCTCATGGGAAGCAGAGGGGACCTCTACCTGGAATCTCCTGACACCTAAAATGTATAGCAAGAAGGACAGGTTAGCTAAAAATGTAGAAGGAGAGAGTTATTGGAAGGAAAGAGAGCTGCAGAACATTCCAAAAATATAA
Full Trace Sequence: ggacaaacacagacagggacaaaagactacgctgacttagagatccagagtcagaactttcctctcacagtcggctataagagactaaatgcctaaaaccaagttggagaagaaagagacatgaggagggcaatcctgttgcctgggatgctgtgtaccggagagtaacaaggggctgtgttacaacagatggctggtggcatcatggcaactttgcacccttcattgctcacaaccctaccgctgccaaagaatctaactaataacacagaggacagttgtgttttcaatgagggattcaagtttttgctgctgcctatctcctacagtggagtgtttatggtgggcctgcctctaaacataacagctatatggatattcattgccaaaatgcgaccatggaaccccacaacagtttatatgtttaaccttgcactgtctgacacactgtatgttctgtctctacccactctggtctattactatgctgaccaaaacaactggccctttggggtagctctctgcaagattgtaagattccttttttatgccaacctctattccagcattctgttcctcacctgcatcagtgtgcaccgctaccggggggtgtgccaccctataaccactctgaggtgtatgaatgctaaacatgcccatgtgatctgtgcactggtatggctatcagttatgctctgccttgtgcccaatttaatgtttgtcacagtcagtccaaaggttaatggcacaatttgtcatgataccacacttcctgaagaatttgacaaatatgtggagtacagtactggaattatgtgcctactctttgggataccgtgcctcataattgcatgctgctatggactcatggcaagagaactaatgaaaccacttgtcaatgggaaccatcagactctaccatcatacaaaaagagatccattaagaccattgtcattgttatgatagcatttgctatttgcttcatgccttttcacatcactcgaaccctgtattattatgcccgtctgctaggtgtcaattgttatgcactcaatgtgataaatttcacatacaagattacacgccctttagccagtgccaacagttgcattgacccaatactctactttctggccaatgacaggtatagacgtaggctgataaggacagtgagaagaagttcagttcatcacaggaggtgtatgcatacaaaccacccagggccccatccagagcctgagccccatatgacaacaggacctttacctgtggtttctgctgaggagacacagagcaatggcagaatggtgagagatgagaatgaagaaggtgccagagagcacagggttggatggacagccagcaaagactcaaagcaaaggaagagtgtgtatcatcaaagcacaatcaagagaaactctatggacaaaaacaatatgaaagaacacagacatggggaaaactatcttccccatgtagaggtagttgaaaaggaagattatgtgacagaaggagagaacagaaaaacaactggacagggagatattgcagagagcaggaaaaccaatgatgaacaggatgagattcagacacaaattagcagcagtcttaaaaaaggaaaatggagactgtcctcaaagaagggtgcaacacaggaatatgaagaaggccatgtggaatcctcatgggaagcagaggggacctctacctggaatctcctgacacctaaaatgtatagcaagaaggacaggttagctaaaaatgtagaaggagagagttattggaaggaaagagagctgcagaacattccaaaaatataagaaggtcttctgatgcaagatcatcgttacaggtatggcatctgttatatgggcctgggccttctgcacatggtgttttcagtaatttgggtcaccatacctaataaacaagaaataaacccaacaggattgttttgccaccaatatggatacgtgcagcttagttaccatcaaatacaaggtcctgttttattatcagagaaaaaaaaatgatatctggtctctggataagagacctcatacctgtagcccataactgtgaattgtaaatattaatttgaacattaaactggtacttctaaagcttttccagcaatgaaccctgtaaaaagctgtacattattgggacactatgaggaattgtccccaaaataatgaacttctcagctgtgtgacattgaaagggacaagaatctgtttgctgtattaaaggtaaagagggcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAGGIMATLHPSLLTTLPLPKNLTNNTEDSCVFNEGFKFLLLPISYSGVFMVGLPLNITAIWIFIAKMRPWNPTTVYMFNLALSDTLYVLSLPTLVYYYADQNNWPFGVALCKIVRFLFYANLYSSILFLTCISVHRYRGVCHPITTLRCMNAKHAHVICALVWLSVMLCLVPNLMFVTVSPKVNGTICHDTTLPEEFDKYVEYSTGIMCLLFGIPCLIIACCYGLMARELMKPLVNGNHQTLPSYKKRSIKTIVIVMIAFAICFMPFHITRTLYYYARLLGVNCYALNVINFTYKITRPLASANSCIDPILYFLANDRYRRRLIRTVRRSSVHHRRCMHTNHPGPHPEPEPHMTTGPLPVVSAEETQSNGRMVRDENEEGAREHRVGWTASKDSKQRKSVYHQSTIKRNSMDKNNMKEHRHGENYLPHVEVVEKEDYVTEGENRKTTGQGDIAESRKTNDEQDEIQTQISSSLKKGKWRLSSKKGATQEYEEGHVESSWEAEGTSTWNLLTPKMYSKKDRLAKNVEGESYWKERELQNIPKI
Donor tissue: neurula