ORFeome > MGC97619 – XORFeome 2.0

MGC97619 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC97619 protein, mRNA (cDNA clone MGC:97619 IMAGE:6978643), complete cds
Gene Symbol: MGC97619
Gene ID: 548533
ORF gb_acc: MG134460
ORF ID: 12163

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090097

Library Location

Plate ID: GDExt11021
Well Location: C03

EST Sequences

Clone: MGC:97619 IMAGE:6978643
Trimmed Sequence: ATGAGCCAGCGCCAGGTTCTTCAGGTTTTTGAGCAGTATCAGCGGGCCAGGACCCAGTTTGTCCAGACAGTTGCAGAGCTTGCTACAAGGCCTCAGAACATCGAAACATTGCAGAATGCAGGCGTTATGTCTCTGCTACGGCCCCTTCTCTTGGACGTGGTCCCAACAATCCAGCAAACCTCTGCTTTGGCTCTCGGGAGACTTGCCAATTACAACGATGATCTGGCAGAAGCCGTTGTTAAAGGAGACATTCTTCCCCAGCTTGTGTATTCTCTGGCTGAACAGAACCGCTTTTACAAGAAGGCAGCAGCCTTTGTGCTACGAGCTGTTGCCAAACACTCTCCTCAGTTAGCTCAGTCAATAGTGGACTGTGGAGCGGTGGATACGCTGGTGATTTGCCTGGAGGACTTTGACCCTGGAGTGAAGGAGTCAGCAGCTTGGGCACTGGGCTATATTTCAAGACACAATGCAGAACTGTCACAGGCCGTGGTGGATGCGGGAGCTGTTCCCTTGCTCGTCCTCTGTATCCAGGAGCCAGAAATCGCCCTGAAAAGGATTGCTGCCTCTGCCTTGAGTGATCTATCAAAGCATTCTCCTGAGCTCGCCCAGACCGTTGTGGATGCAGGGGCAATAGCCCACTTAGCTCAGATGATTCTCAATCCAGATGCTAAACTCAAGCGCCAGGTGCTGTCTGCCCTAAGCCAAATTGCTAAGCATTCCGTTGACCTGGCGGAAATGGTGGTAGAAGCCGAAATCTTCCCTGTCGTCTTGACGTGTCTGAAGGACCCTGATGAATATGTTAAGAAAAATTCATCTACGCTGATCCGAGAAATTGCACGGCACACCCCCGAGCTCTCTCAGTTGATAGTGAATGCGGGAGGAGTGGCTGCTGTCATTGATTGCATTGGAAATTGCAGCGGGAATGTGAGGCTTCCCGGCATCATGATGCTGGGTTATGTGGCAGCTCATTCTGAGAACCTGGCAATGGCCGTCATTATCTCAAAGGGGGTACCACAATTAGCCATCTGCCTGTCAGAGGAAGCAGAAGATCACATAAAGGCAGCTGCTGCCTGGTCGCTGGGCCAGATTGGAAGACACACTCCAGAGCATGCACGTGCTGTTGCTGTTGCCAATGTATTGCCAAAGCTGCTTTCCCTATACATGGACACAGACAGCTCCGAGGACCTCCAAGTGAAGGCAAAGAAGGCCTTAAAGAACATACTGCAGAAGTGTACCCATCTGCCAGCGCTGGAGCCCTTGCTGCACGATGCACCGCCTAATATCCTGAAGCATGTGGTCGGGCAGTTCAGCAAGGTTCTTCCACACGACAGCAAAGCAAGGCGACTATTTGTCACAAGTGGGGGGCTGAAAAAGATTCAAGAGATAGTGGCAGACACGGGCTCACCCCTCCAAGAATACATCAACACCATCAACAACTGTTTTCCTGAAGAGATTGTCAGATACTATTCTCCCGGATACTCCCAGTCACTTCTAGAAAGGGTGGATCACTACCAGCCAGTTATTTAA
Full Trace Sequence: cacagacagagacatgagccagcgccaggttcttcaggtttttgagcagtatcagcgggccaggacccagtttgtccagacagttgcagagcttgctacaaggcctcagaacatcgaaacattgcagaatgcaggcgttatgtctctgctacggccccttctcttggacgtggtcccaacaatccagcaaacctctgctttggctctcgggagacttgccaattacaacgatgatctggcagaagccgttgttaaaggagacattcttccccagcttgtgtattctctggctgaacagaaccgcttttacaagaaggcagcagcctttgtgctacgagctgttgccaaacactctcctcagttagctcagtcaatagtggactgtggagcggtggatacgctggtgatttgcctggaggactttgaccctggagtgaaggagtcagcagcttgggcactgggctatatttcaagacacaatgcagaactgtcacaggccgtggtggatgcgggagctgttcccttgctcgtcctctgtatccaggagccagaaatcgccctgaaaaggattgctgcctctgccttgagtgatctatcaaagcattctcctgagctcgcccagaccgttgtggatgcaggggcaatagcccacttagctcagatgattctcaatccagatgctaaactcaagcgccaggtgctgtctgccctaagccaaattgctaagcattccgttgacctggcggaaatggtggtagaagccgaaatcttccctgtcgtcttgacgtgtctgaaggaccctgatgaatatgttaagaaaaattcatctacgctgatccgagaaattgcacggcacacccccgagctctctcagttgatagtgaatgcgggaggagtggctgctgtcattgattgcattggaaattgcagcgggaatgtgaggcttcccggcatcatgatgctgggttatgtggcagctcattctgagaacctggcaatggccgtcattatctcaaagggggtaccacaattagccatctgcctgtcagaggaagcagaagatcacataaaggcagctgctgcctggtcgctgggccagattggaagacacactccagagcatgcacgtgctgttgctgttgccaatgtattgccaaagctgctttccctatacatggacacagacagctccgaggacctccaagtgaaggcaaagaaggccttaaagaacatactgcagaagtgtacccatctgccagcgctggagcccttgctgcacgatgcaccgcctaatatcctgaagcatgtggtcgggcagttcagcaaggttcttccacacgacagcaaagcaaggcgactatttgtcacaagtggggggctgaaaaagattcaagagatagtggcagacacgggctcacccctccaagaatacatcaacaccatcaacaactgttttcctgaagagattgtcagatactattctcccggatactcccagtcacttctagaaagggtggatcactaccagccagttatttaactctgtcccctatttatatcattgttattattgctcacttggtttgatatcaataaagaaatatttgccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSQRQVLQVFEQYQRARTQFVQTVAELATRPQNIETLQNAGVMSLLRPLLLDVVPTIQQTSALALGRLANYNDDLAEAVVKGDILPQLVYSLAEQNRFYKKAAAFVLRAVAKHSPQLAQSIVDCGAVDTLVICLEDFDPGVKESAAWALGYISRHNAELSQAVVDAGAVPLLVLCIQEPEIALKRIAASALSDLSKHSPELAQTVVDAGAIAHLAQMILNPDAKLKRQVLSALSQIAKHSVDLAEMVVEAEIFPVVLTCLKDPDEYVKKNSSTLIREIARHTPELSQLIVNAGGVAAVIDCIGNCSGNVRLPGIMMLGYVAAHSENLAMAVIISKGVPQLAICLSEEAEDHIKAAAAWSLGQIGRHTPEHARAVAVANVLPKLLSLYMDTDSSEDLQVKAKKALKNILQKCTHLPALEPLLHDAPPNILKHVVGQFSKVLPHDSKARRLFVTSGGLKKIQEIVADTGSPLQEYINTINNCFPEEIVRYYSPGYSQSLLERVDHYQPVI
Donor tissue: tailbud