ORFeome > MGC97639 – XORFeome 2.0

MGC97639 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC97639 protein, mRNA (cDNA clone MGC:97639 IMAGE:6980080), complete cds
Gene Symbol: MGC97639
Gene ID: 548535
ORF gb_acc: MG134410
ORF ID: 12103

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090100

Library Location

Plate ID: GDExt11021
Well Location: F02

EST Sequences

Clone: MGC:97639 IMAGE:6980080
Trimmed Sequence: ATGGCACCTGCTGTTGGAGGCCCAGTGGGATACACTCCCCCAGAAGGGGGCTGGGGCTGGGTAGTAGTTGTAGCAGCCTTTGTGTCGATTGGATTCTCATATGCCTTCCCCAAATCAATTACAGTCTTTTTCAAAGACATAGAGGCAATCTTTGGAGCAACAAGTAGCGAGGTATCCTGGATTTCTTCTATAATGCTGGCTGTAATGTATGCTGGAGGTCCAATAAGCAGTGTCTTGGTGAACAAGTATGGAAGTCGTCCTGTTATGATTGCTGGTGGTTGCCTTGCTGGGACTGGATTAATAGCTGCTTCATTTTGTAACACTGTCGCTGAGCTGTACCTTTGTATTGGTGTTGTTGGAGGTTTTGGTCTTGCATTCAACTTAAACCCAGCTTTGACAATGATTGGTAAATATTTCTTTAAGAAAAGACCCATAGCAAATGGATTGGCTATGGCAGGAAGTCCTGTATTTTTGTCCACTTTAGCTCCTCTGAATCAGTACTTCTACAGTATTTTTGGGTGGAGAGGAAGCTTCCTGATTTTGGGTGGTCTTCTGTTTAACTGCTGTGTTGCTGGGTCTTTGATGCGTCCCATAGGACCAAAGCCAGAAGATACAAAAAAGAAAGTGACAAAAGAAGTGTTGGAAGAGGCTGGAAAGTGTTTTTCTAAAGAAGATGGGGATGCCCATAAAGACCTTATAGAGGGCAAGGCAAAAACTAAGCCAACACTGTTCCAGACCATAAATAAGTTCCTAGACCTTTCTCTCTTCACTCATCGTGGATTTCTTCTCTACCTGTCGGGGCACATGATTATGTTTTTTGGACTGTTTGCTCCTTTAGTCTTTCTTAGCAACTATGCAAAAAGCAAGAACATTTCACCTGAGTCTGCTGCATTTCTGCTTTCAATTCTTGCAATTGTAGATATGATTGCAAGGCCCTCCATGGGAATTGTGGCAAACACCAAATGGGTGAGACCTAAAATTCAATATTTCTTTGCTGTTGCAGTTTTGTACAATGGAATATGCCACCTTCTGGTTCCCCTTTCAACATCTTATGTAGGCTTTTGTATTTATGCTGGTTTCTTTGGTTTTGCTTTTGGTTGGCTTAGCTCTGTCCTCTTTGAAACACTTATGGACTTGGTTGGAGCCCAGAGATTCTCAAGTGCTGTTGGATTAGTCACGATTGTGGAATGCTGTCCTGTGCTTCTAGGACCACCACTGTTAGGAAGGTTGAATGATATATATGGAGACTACAAATACACCTATCAAGCTTGTGGAATAGTTCTAATTGTTGCTTCAGTCTACCTCTTCATTGGGATGACAATCCACTACAGACTATTGGCAAAGGAACAAAAAGCAGAGCAGAAAAAAGCACAGGAAGCAAATGCAGGGGCATCGGAGAACAAAGTGAATGAACTCTCTGTCCTTCCTCAAAATTCTGATGATGTTTTGAAAGAAGATGAAAGTCACATATGA
Full Trace Sequence: cctttcgcgccagcctgtaccgggatacagtgtaactaacgatatttaattctggaaagaaacttcccagagaatggcacctgctgttggaggcccagtgggatacactcccccagaagggggctggggctgggtagtagttgtagcagcctttgtgtcgattggattctcatatgccttccccaaatcaattacagtctttttcaaagacatagaggcaatctttggagcaacaagtagcgaggtatcctggatttcttctataatgctggctgtaatgtatgctggaggtccaataagcagtgtcttggtgaacaagtatggaagtcgtcctgttatgattgctggtggttgccttgctgggactggattaatagctgcttcattttgtaacactgtcgctgagctgtacctttgtattggtgttgttggaggttttggtcttgcattcaacttaaacccagctttgacaatgattggtaaatatttctttaagaaaagacccatagcaaatggattggctatggcaggaagtcctgtatttttgtccactttagctcctctgaatcagtacttctacagtatttttgggtggagaggaagcttcctgattttgggtggtcttctgtttaactgctgtgttgctgggtctttgatgcgtcccataggaccaaagccagaagatacaaaaaagaaagtgacaaaagaagtgttggaagaggctggaaagtgtttttctaaagaagatggggatgcccataaagaccttatagagggcaaggcaaaaactaagccaacactgttccagaccataaataagttcctagacctttctctcttcactcatcgtggatttcttctctacctgtcggggcacatgattatgttttttggactgtttgctcctttagtctttcttagcaactatgcaaaaagcaagaacatttcacctgagtctgctgcatttctgctttcaattcttgcaattgtagatatgattgcaaggccctccatgggaattgtggcaaacaccaaatgggtgagacctaaaattcaatatttctttgctgttgcagttttgtacaatggaatatgccaccttctggttcccctttcaacatcttatgtaggcttttgtatttatgctggtttctttggttttgcttttggttggcttagctctgtcctctttgaaacacttatggacttggttggagcccagagattctcaagtgctgttggattagtcacgattgtggaatgctgtcctgtgcttctaggaccaccactgttaggaaggttgaatgatatatatggagactacaaatacacctatcaagcttgtggaatagttctaattgttgcttcagtctacctcttcattgggatgacaatccactacagactattggcaaaggaacaaaaagcagagcagaaaaaagcacaggaagcaaatgcaggggcatcggagaacaaagtgaatgaactctctgtccttcctcaaaattctgatgatgttttgaaagaagatgaaagtcacatatgagaattttccaatttgccttacatatagtactgagtggatatattaaaaaggtggttgattgcggtatttcccatttttaggttaggattttattttttaaactctggctgtttttatacattgaatttgtcagatggaactttgtggcatgagccgtttgtcagtgggtgccttatgccagctgtctttcaggacctttttttagttttttttttctttaatgaaacttctggaactaatcttagcaatgaccatttttgccctgattttattctgctatgacattggacaaattagtaaacgaaaagcattcggtcttccagggatggcttgggcgggaatgagatgctgctacagttttagcaactttttgtagatgtggttccaggcgtgctcttcagtattaaatttaactccctaaatgttttcagcagcacccccaaaacacttgtagaagcataatgttatgagttgcttcttatgatcatgcttttgcttgtagttttttttttttttttccttgcagtgccttttgtttgtacttgctatttcaaagtgtttgtgcaatataggaggccagtaaaaggccagagtttgagtgttgtcttgttactaatgctaccttaatgggttgttaaatttttgagctatacacacaccctcagggcataatttacttttactgtatatatgctgtaagctttcttgtacataggtttttaaattgcatagtttgccttttcgatagtatgggtgtgtctgtgagattaaatacttcttgaaaatcctgggaataaaaacattcagaactaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAPAVGGPVGYTPPEGGWGWVVVVAAFVSIGFSYAFPKSITVFFKDIEAIFGATSSEVSWISSIMLAVMYAGGPISSVLVNKYGSRPVMIAGGCLAGTGLIAASFCNTVAELYLCIGVVGGFGLAFNLNPALTMIGKYFFKKRPIANGLAMAGSPVFLSTLAPLNQYFYSIFGWRGSFLILGGLLFNCCVAGSLMRPIGPKPEDTKKKVTKEVLEEAGKCFSKEDGDAHKDLIEGKAKTKPTLFQTINKFLDLSLFTHRGFLLYLSGHMIMFFGLFAPLVFLSNYAKSKNISPESAAFLLSILAIVDMIARPSMGIVANTKWVRPKIQYFFAVAVLYNGICHLLVPLSTSYVGFCIYAGFFGFAFGWLSSVLFETLMDLVGAQRFSSAVGLVTIVECCPVLLGPPLLGRLNDIYGDYKYTYQACGIVLIVASVYLFIGMTIHYRLLAKEQKAEQKKAQEANAGASENKVNELSVLPQNSDDVLKEDESHI
Donor tissue: tailbud