ORFeome > mtdh – XORFeome 2.0

mtdh – XORFeome 2.0

General Information

Species: Xenopus tropicalis metadherin, mRNA (cDNA clone MGC:75963 IMAGE:5384140), complete cds
Gene Symbol: mtdh
Gene ID: 394771
ORF gb_acc: MG133501
ORF ID: 11025

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC063364

Library Location

Plate ID: GDExt11010
Well Location: F01

EST Sequences

Clone: MGC:75963 IMAGE:5384140
Trimmed Sequence: ATGGCCGCTGGTTGGCAGGAGGCTGCGGCCCAGCAGGCCGAGGAGGTGTCTGCCCGTGTAAGGCAGCTGGTCAGCACCGGGCTCGGCCTTCTCCGCACGGAGCTGGGTGTGGACCTTGGCCTGCAGCCCCAGCGCTACCCGGCCTGGGTGTTCCTGGCGGTACCGCTGTCCCTGGGCCTCTTGCTCCTGTTCCTATGTGCCGGGGCACTTGGGCGCAGCTCCGCCGGTAAGAAGCGGCTCAGGGAGCAGAGAGAAGCGCCGGTGCAGCTGGAGAAGCCCATCCCCGTCCCCAAGAGCGTCAAAGCCGAGGATCCGAAGAAAAAGAACAAGAAAAAAACAACGGAGAAACCAAAGCCTAATGGAAGACCCGTTGAGCTGGTGGAGGAGGAGATAACACCCATAGTCAAAAAGGAGAGCCTGAAACCGCCTTTGGAAACTGAAAAGAAGAACGAAAAGGCAAAAAAGAATAAGAAGAAACCTAAGACTGATGCAAAGCAAACACAACAGTCCTCAAATCAAGATAAAAAAGAAGCCGAAGAAGGGAATTGGGAAACGAAAATCAGCAACCGGGAAAAGCGCCAGCAGCGTAAGCGCGATAAGGACTCTGAAATAAATATTGTTGAAACTATAACTTCTGTTGTGAGTGAGCCGTTTCCATCTGCGCCATCTCATTCTGCAGGCGCCAGGAAATCCAAAGGTACAAATGACAATAATGTGGTTAATGGAAGTGGTTGGAGTGAGAAGCCGTCAAAGACTCTCTCCTCCCAGCTTGGAGAAGAAAAGTGGGCCCCTTCAGCTAGCAAGAAGAAAGCAGAGCCTTGCACTTGGAATCAAAATGCCAGTGACACTAATGGGAAAGACTGGGGTGTATCTTGGGGCGAGCGTCCGATCTTTCCTAGCATATCTGCATGGTCTAATGTGGATGGAAGAATGACTGTTCCTGAACAGAGACAAACTTCATTTGCTGCCATGGGACTAAATAATTCTGTGCCCGCTTCTGTAAGCGAACCCATTTCTCAGCCGGCTACCTCTGAAAGCCAGTGGGATTCTACCCCCAATGAACCGTGTATTGATGATGAATGGTCTGGCCTAAATGGCCTGAACTCATCTGACCCCACTTCTGACTGGAATGCGCCAGCAGAGGAATGGGGGAACTGGGGTACAGAAGAGCCAGTGAACGCTACACAACCTGAAGAGTCTGAACAGCTTACAAAGGTATCCGAAGAAGAAAAGGAAAAGGAAGAATCTTCTGCTCAAGGTGCAGCAAGCAGCAAAACCAAGAAGAAGAAGAAAAAAAAGAAGAAGCAAGGAGAGGAATCAGGCTCTGCACAGGATGCTGAGAATCCTGAGAGGGAAACTACAGGTGAATTCCATGAAGATAAAGCTCCAGCTCCCCCCCAGCCAGAGAGAATTAGCCCTGCTGTGGTTTTAAAGGCTAGTGAACCTAAGAAACAACCTGAAGAGGAGACTCGTCATCATAATGTATTTACTGAGCCTTCAGTACCAGTCAAACACAGCGTTTCTGAAAAGAGTCCTTCCCAAGTGCAACAGCCACAGGAGAAAAGCTCTTCCAATAGCAAGCAGAATAGTGTGCCTCCATCCTCACAAGCTAAATCCGAAGAGAGCTGGGAATCTCCAAAACAAGTGAAAAAGAAGAAGAAAGCCAGAAGGGAAACGTGA
Full Trace Sequence: ctgggcggagccgggacgctacgtttcactttctgccagccttttggtgcgtctcagtgccagtgagaggctgctggtgtgggcaggcaggcaaggggcagcagtgtgtagctggcagcgctagagccatggccgctggttggcaggaggctgcggcccagcaggccgaggaggtgtctgcccgtgtaaggcagctggtcagcaccgggctcggccttctccgcacggagctgggtgtggaccttggcctgcagccccagcgctacccggcctgggtgttcctggcggtaccgctgtccctgggcctcttgctcctgttcctatgtgccggggcacttgggcgcagctccgccggtaagaagcggctcagggagcagagagaagcgccggtgcagctggagaagcccatccccgtccccaagagcgtcaaagccgaggatccgaagaaaaagaacaagaaaaaaacaacggagaaaccaaagcctaatggaagacccgttgagctggtggaggaggagataacacccatagtcaaaaaggagagcctgaaaccgcctttggaaactgaaaagaagaacgaaaaggcaaaaaagaataagaagaaacctaagactgatgcaaagcaaacacaacagtcctcaaatcaagataaaaaagaagccgaagaagggaattgggaaacgaaaatcagcaaccgggaaaagcgccagcagcgtaagcgcgataaggactctgaaataaatattgttgaaactataacttctgttgtgagtgagccgtttccatctgcgccatctcattctgcaggcgccaggaaatccaaaggtacaaatgacaataatgtggttaatggaagtggttggagtgagaagccgtcaaagactctctcctcccagcttggagaagaaaagtgggccccttcagctagcaagaagaaagcagagccttgcacttggaatcaaaatgccagtgacactaatgggaaagactggggtgtatcttggggcgagcgtccgatctttcctagcatatctgcatggtctaatgtggatggaagaatgactgttcctgaacagagacaaacttcatttgctgccatgggactaaataattctgtgcccgcttctgtaagcgaacccatttctcagccggctacctctgaaagccagtgggattctacccccaatgaaccgtgtattgatgatgaatggtctggcctaaatggcctgaactcatctgaccccacttctgactggaatgcgccagcagaggaatgggggaactggggtacagaagagccagtgaacgctacacaacctgaagagtctgaacagcttacaaaggtatccgaagaagaaaaggaaaaggaagaatcttctgctcaaggtgcagcaagcagcaaaaccaagaagaagaagaaaaaaaagaagaagcaaggagaggaatcaggctctgcacaggatgctgagaatcctgagagggaaactacaggtgaattccatgaagataaagctccagctcccccccagccagagagaattagccctgctgtggttttaaaggctagtgaacctaagaaacaacctgaagaggagactcgtcatcataatgtatttactgagccttcagtaccagtcaaacacagcgtttctgaaaagagtccttcccaagtgcaacagccacaggagaaaagctcttccaatagcaagcagaatagtgtgcctccatcctcacaagctaaatccgaagagagctgggaatctccaaaacaagtgaaaaagaagaagaaagccagaagggaaacgtgatcgtccccccggccaatggagcacatgttcagacactatctcggagattatgctgtttatgcaataatttgtgaacatgtacagaatttttatatgtttggtctctatttttaaaacaactgctgtcaatgtgatctaagacaggaggataaaaaaaaaaattaactctgacctatgaggttaacatgcaagagtactggaaaatcattggaagatgcgtttgttttttttttgttttttggccaacttggaacgttcgcaatttgataggagaaaggtgtgtttaattcctgattttataaagcagtgacctgttgacattcatattgtgccctatgttgtctctcaattggtggaagattgattgaccatttctgtacctttttaaacgtcacgcttgtgcgtgtgctagctgtgtgtacgccacatcaccgacaccagtgtgcagaaattacacggatgagcgaacatcggcgcttgcagcgctgaagaggattaatgtgcgcgtggatccttatactgtataggtttttttctttctgccctcgaagtattttgtctcagtataaatctaacttaattttttttaggcaagtacggaatgtttaataagtctcttcctgttctaatgtacttttatccatttgacttttcggcaactcccagtattcctcaggcagctggagtggtgggagttgtagttctatatctggtgagccccctggttgcccatccctgcttttccgcatacattttacctatggtatgactgagcaaattctgttttgtaatggatatgatggtggcctttataaggaatcattcttacttttctattccatcccattagaaagacacacacccttttcagtgttaatgtgaactttacttaaagggtatggtggctttggacagctttaactgacgttgtcaagacctccaataatcaggaatgttttttactgccttaatctgtagtatgtacaacctatccgtagattccataaataatactctcataatgtgccacggctgctgtgatttgggggcaaagcttcccagctccagaccgtagagggcgccatttcatcactacctacaggcactgtcgctctgtttctttgaccccgcagatccgtttgtaatctcagaatcgtgcatgataagtcatactttgtaaatagccttaccaaaatgtgcttttggacaaggaccatcactagaaaacgtgtatgaaacaaagccatgaatgatgtatttcgtcctgctttatccaatggcacctcactgaccaatcaattcagttttgggtcagtccttggtgccattaacctcttctctgccagagtagacagcaatacattgcgttgctgctcttttctctaccaaggtgtttaaggggcattgcagtagcttcatagtgagtatgttgagcgctgtttatggaactttttttcctgataaacttactaatttttacaccagtgtattaaaacaatctgtttcaggaacatgaaaagtatgtttacatgttcagaagttttgtttaattctgtgaaatttctaagttgatttgtttaaataaaatcttgcaaattccgtaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAAGWQEAAAQQAEEVSARVRQLVSTGLGLLRTELGVDLGLQPQRYPAWVFLAVPLSLGLLLLFLCAGALGRSSAGKKRLREQREAPVQLEKPIPVPKSVKAEDPKKKNKKKTTEKPKPNGRPVELVEEEITPIVKKESLKPPLETEKKNEKAKKNKKKPKTDAKQTQQSSNQDKKEAEEGNWETKISNREKRQQRKRDKDSEINIVETITSVVSEPFPSAPSHSAGARKSKGTNDNNVVNGSGWSEKPSKTLSSQLGEEKWAPSASKKKAEPCTWNQNASDTNGKDWGVSWGERPIFPSISAWSNVDGRMTVPEQRQTSFAAMGLNNSVPASVSEPISQPATSESQWDSTPNEPCIDDEWSGLNGLNSSDPTSDWNAPAEEWGNWGTEEPVNATQPEESEQLTKVSEEEKEKEESSAQGAASSKTKKKKKKKKKQGEESGSAQDAENPERETTGEFHEDKAPAPPQPERISPAVVLKASEPKKQPEEETRHHNVFTEPSVPVKHSVSEKSPSQVQQPQEKSSSNSKQNSVPPSSQAKSEESWESPKQVKKKKKARRET
Donor tissue: neurula