ORFeome > myod1 – XORFeome 2.0

myod1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis myogenic differentiation 1, mRNA (cDNA clone MGC:75960 IMAGE:5384107), complete cds
Gene Symbol: myod1
Gene ID: 394569
ORF gb_acc: MG133010
ORF ID: 10397

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061388

Library Location

Plate ID: GDExt11004
Well Location: D08

EST Sequences

Clone: MGC:75960 IMAGE:5384107
Trimmed Sequence: ATGGAGCTGTTGCCCCCACCGCTGCGGGACATGGAGGTCACTGAGGGGTCTCTCTGCTCCTTCCCGACCCCCGATGACTTCTACGACGACCCCTGTTTCAATACCTCGGACATGAGCTTCTTTGAGGACCTGGACCCCAGACTGGTGCATGTAGCCCTCCTGAAGCCGGAGGACCCCCACCATAATGAGGATGAGCATGTGCGGGCCCCCAGCGGGCACCACCAGGCGGGCAGGTGTCTCTTGTGGGCATGCAAAGCCTGTAAGAGGAAGACCACCAACGCCGACAGGAGGAAGGCCGCCACTATGAGGGAGAGGAGGAGGCTCAGTAAGGTCAATGAGGCGTTTGAGACCCTCAAGCGATGCACCTCGACCAACCCCAACCAGAGGCTCCCGAAAGTGGAGATTTTGCGCAACGCGATTCGCTACATAGAAAGTCTCCAGTCTCTTCTCCGCGGCCAGGAGGAGTCTTTCTACCCCGTACTGGAGCATTATAGCGGGGACTCTGATGCCTCCAGCCCCCGGTCCAACTGCTCCGATGGCATGACAGACTATAGCCCCCCCTGCGGCTCCAGGAGAAGGAACAGCTACGACAGCAGCTTCTACAGCGACAGCCCAAATGGGCTGAGACTTGGGAAGAGCTCGGTGATCTCCAGCCTCGACTGTCTCTCCAGCATCGTCGAGCGAATCTCCACCGAGAGCCCCGTCTGCCCCGTCATTCCGGCTGCGGATAGCGGCTCCGAGGGCAGTCCCTGTTCCCCCCTGCAGGGGGAGACACTGAGTGAGAGCGGAATCATTATCCCTTCTCCCAGCAACCCCTGCACCCACCTGTCCCAGGATCCCAGCAGCACAATCTACCAGGTCTTATAG
Full Trace Sequence: tttgtgggtatctgggccggaccccccgggcttggatttgtgggaccctcgctggaagtatagttactttgcgccgttgctatggagctgttgcccccaccgctgcgggacatggaggtcactgaggggtctctctgctccttcccgacccccgatgacttctacgacgacccctgtttcaatacctcggacatgagcttctttgaggacctggaccccagactggtgcatgtagccctcctgaagccggaggacccccaccataatgaggatgagcatgtgcgggcccccagcgggcaccaccaggcgggcaggtgtctcttgtgggcatgcaaagcctgtaagaggaagaccaccaacgccgacaggaggaaggccgccactatgagggagaggaggaggctcagtaaggtcaatgaggcgtttgagaccctcaagcgatgcacctcgaccaaccccaaccagaggctcccgaaagtggagattttgcgcaacgcgattcgctacatagaaagtctccagtctcttctccgcggccaggaggagtctttctaccccgtactggagcattatagcggggactctgatgcctccagcccccggtccaactgctccgatggcatgacagactatagccccccctgcggctccaggagaaggaacagctacgacagcagcttctacagcgacagcccaaatgggctgagacttgggaagagctcggtgatctccagcctcgactgtctctccagcatcgtcgagcgaatctccaccgagagccccgtctgccccgtcattccggctgcggatagcggctccgagggcagtccctgttcccccctgcagggggagacactgagtgagagcggaatcattatcccttctcccagcaacccctgcacccacctgtcccaggatcccagcagcacaatctaccaggtcttataggcccagactgccccctgctggtgactcacttccactcattcttcccaatccatgaacttaccccgtatttatctgtttgccccggacagaggcttctgccccactgggaaccaccgagcccccaccgtcctgggtctccaatcaaattgcggctggcgttgaaggacagaccactccttaggggttacatgacccccccaaacggacaatgaattcccccccccccccggggcaaaccaaaggaaatctgaggaccactttttgtaagactttttatagatttgtaaataagagacgattgcaaggaatttgccctatttatgtactcggtgtgttatatatttatatgtgtgcgactccggaaccttccggaaccttctaaataaagaaccttatttataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MELLPPPLRDMEVTEGSLCSFPTPDDFYDDPCFNTSDMSFFEDLDPRLVHVALLKPEDPHHNEDEHVRAPSGHHQAGRCLLWACKACKRKTTNADRRKAATMRERRRLSKVNEAFETLKRCTSTNPNQRLPKVEILRNAIRYIESLQSLLRGQEESFYPVLEHYSGDSDASSPRSNCSDGMTDYSPPCGSRRRNSYDSSFYSDSPNGLRLGKSSVISSLDCLSSIVERISTESPVCPVIPAADSGSEGSPCSPLQGETLSESGIIIPSPSNPCTHLSQDPSSTIYQVL
Donor tissue: neurula