ORFeome > n4bp1 – XORFeome 2.0

n4bp1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis nedd4 binding protein 1, mRNA (cDNA clone MGC:79624 IMAGE:6979823), complete cds
Gene Symbol: n4bp1
Gene ID: 448184
ORF gb_acc: MG133602
ORF ID: 11139

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075104

Library Location

Plate ID: GDExt11011
Well Location: B06

EST Sequences

Clone: MGC:79624 IMAGE:6979823
Trimmed Sequence: ATGGCTTCGGGTTCCGTCCAGAGTTCGTCAGGCAATGGCAGAAGACAAGCGGCAGTGGTGGATGAGTTTACAGTTCCGGGAGATAAGAGGAGCCTTTTGGAAAAGAGCCGCCCTAGGATCCAGGCCTTGTTCCCGGTGCTGTTTACAGTGCTGGGTTCGTTGGAAACCTTTCAGCAGTCTGAAGTGAAAGAGGACGAGGAGAAGCCAGGTCGGATATGGCTGCAGCTGAAGGGAGAGAAGCAAGCTGTGCGCAGAGCAAAGGAATATGTGAAAGGCATCTGTGAGCCGGAATTGGAGGAAAAGCAGAGTTATCCAAAGGAAATGCATTGCATCTTTGCAGGGGCCCAGAGTTCCTTTCTTAATCATCTTATTCAGGACACTTGTGCAGATGTGGCTCTATCGGACATAGGGGTCCTCGGTATTAAGGGAGCAACTGAACCAGTGGTAATGGCACAAAGTCGTGTTCAGCAGTTCATTGCGCTTTTTAAAGATAATCTAAGTTTACCCAGTCACAAAGAACCTGCAGTGAAAAAAAAGTTTAAATTGTATGTTGAAAAACATGTCGACAAGTATACAGTTGACTTATTGCTATTGCCAAGTGCACTGAAAAGTGAACTCTTAAGTCTTGCATGTGACAACCAACTTTCATGTGAGGATCTCTCAAGGCAGAGTTCAGATGACAAAGCTGAATGCAAAGTAAACCAAAAAGATGAAGTGTCTAGAAAAGGAGCAGGGACTCCAGTAACAGAACTTACAAGTCAGCTGGATTCTGTGTTTTCAAGTGCAGCAGAAGATAGCCCATGCCTGATAGAATGTCCATATTCTGAACAAGACCGTCTGTCCGTTAAAAGACGTAGCTCGGAAGCAGAGGAAAGGTTCTCCAAAAAGCCATTTTCTTTAGAGGCTGTTCAAGTAGATGGCCCTGTTAACAGAAATGCTGACAAAAACAATGTTCCCATTATTGACTTGATATCGGAACCTAGTGACTTTGAAGATTCAGTGATAGTTGTGGAAGCTGATGACTGCGTGAGTTCGGAAACAGAGTATAAAATACTTGTTAACTTCTTCAAAACTATGGGGTATTCTCAGATTGTAGTTGAGAAGGTAATTGATGATCTTGGACAATCAGAAGAACCATTAAAACTTCTAGAAGAAATAGAAAAGCAGAGTAAAAAAGAGCTGTCTGTACCCTTTAGCCAATCCAGCAGTTATAGTACAGACCTGCTGAAGGCCAGAGGTACTTCAAGTCTGCCTAAATGTAAAATTGCCATAGCTGAGACTGTACAATCTGCAGCACCGTCAAAAGTGCAACCTAAAGCTTTACTTGCCACAGACAAAGCAGGACCTTCCAATCCCTTTTGTTACAAATCCCAGACAAAAGCAACTGTGGTAAATCCTATACCTACAGATCAGACAACTATTGTGGCACCAGCTGAAAGAGCCTTTAATAATCACTTTGATCCTCCTTTAACTGGAGTACAGATATTCCAAAATTCTTTAAAAGTACAATATCGATTAGAACTGAAAAATGAGCCTGGAAGATGGGACTTGAAACATATTATCATAGATGGCAGCAATGTTGCAATGAGCCATGGATTGCAAAGATTCTTTTCTTGTCGAGGCATAGCCTTAGCTGTTGAATACTTTTGGAAGAAGGGTCACCGGAATATTACAGTTTTTGTTCCACAGTGGAGAACAAAACGTGATCCTTTTATCACAGAACAGCACTTCTTACAGCAACTGCAGGAACTGGGAATTCTGTCATTTACTCCCTCCAGGACAGTGCTGGGAGCTCGAATTGCATCACATGATGATAGGTTTCTTTTGCATCTTGCTGAGAGAACTGGAGGTATAATCATAACAAACGATAACTTCAGAGAATTTGTTGTTGAATCACCAAGTTGGAGGGAAATTATTAAAGAAAGATTGTTGCAGTACACTTTTGCTGGTGACATTTTTATGTTACCTGATGATCCATTAGGAAGATATGGGCCCAAGCTGGATGATTTCCTCAGCAAACAGCCAAACAACCGAACTGTGCACAGCAGTTTTCCATCCAGCAATGAAAGGTTCGTTCCTAGGGATCAGTTTGCTCCTCCAAGAAACATGGCACCAAAAACTGGACTTAATCAGCCCATGGCACCAAGAGCCGGACATAATCAGCCCATGGCACCAAGAGCCGGACATAATCAGCCCATGGCACCAAGAACCGGACTTAGTCAACACAGATTCTTGCAACTGATTAAACCACAAGAACCTTTTACACCAGCTCTGCACAATATTGCCCGGCCCTGTCCTATAATGCCTCCAGAGAGAAGTCCATCTGAGACCATGCAATTAAAAGAAGCCCTTTTGAAAATATTTCCAGAGGCAGACCAGAGACATAAAATAAATGAGATATTAACAGCCCACCCATTTATGAGGGACCTTAATGCACTGTCAGCAATGGTACTTGATTAA
Full Trace Sequence: ggccgctctaccgtttaggaatggcgctccaggggtaaggtgagggaaagttaccatggcttcgggttccgtccagagttcgtcaggcaatggcagaagacaagcggcagtggtggatgagtttacagttccgggagataagaggagccttttggaaaagagccgccctaggatccaggccttgttcccggtgctgtttacagtgctgggttcgttggaaacctttcagcagtctgaagtgaaagaggacgaggagaagccaggtcggatatggctgcagctgaagggagagaagcaagctgtgcgcagagcaaaggaatatgtgaaaggcatctgtgagccggaattggaggaaaagcagagttatccaaaggaaatgcattgcatctttgcaggggcccagagttcctttcttaatcatcttattcaggacacttgtgcagatgtggctctatcggacataggggtcctcggtattaagggagcaactgaaccagtggtaatggcacaaagtcgtgttcagcagttcattgcgctttttaaagataatctaagtttacccagtcacaaagaacctgcagtgaaaaaaaagtttaaattgtatgttgaaaaacatgtcgacaagtatacagttgacttattgctattgccaagtgcactgaaaagtgaactcttaagtcttgcatgtgacaaccaactttcatgtgaggatctctcaaggcagagttcagatgacaaagctgaatgcaaagtaaaccaaaaagatgaagtgtctagaaaaggagcagggactccagtaacagaacttacaagtcagctggattctgtgttttcaagtgcagcagaagatagcccatgcctgatagaatgtccatattctgaacaagaccgtctgtccgttaaaagacgtagctcggaagcagaggaaaggttctccaaaaagccattttctttagaggctgttcaagtagatggccctgttaacagaaatgctgacaaaaacaatgttcccattattgacttgatatcggaacctagtgactttgaagattcagtgatagttgtggaagctgatgactgcgtgagttcggaaacagagtataaaatacttgttaacttcttcaaaactatggggtattctcagattgtagttgagaaggtaattgatgatcttggacaatcagaagaaccattaaaacttctagaagaaatagaaaagcagagtaaaaaagagctgtctgtaccctttagccaatccagcagttatagtacagacctgctgaaggccagaggtacttcaagtctgcctaaatgtaaaattgccatagctgagactgtacaatctgcagcaccgtcaaaagtgcaacctaaagctttacttgccacagacaaagcaggaccttccaatcccttttgttacaaatcccagacaaaagcaactgtggtaaatcctatacctacagatcagacaactattgtggcaccagctgaaagagcctttaataatcactttgatcctcctttaactggagtacagatattccaaaattctttaaaagtacaatatcgattagaactgaaaaatgagcctggaagatgggacttgaaacatattatcatagatggcagcaatgttgcaatgagccatggattgcaaagattcttttcttgtcgaggcatagccttagctgttgaatacttttggaagaagggtcaccggaatattacagtttttgttccacagtggagaacaaaacgtgatccttttatcacagaacagcacttcttacagcaactgcaggaactgggaattctgtcatttactccctccaggacagtgctgggagctcgaattgcatcacatgatgataggtttcttttgcatcttgctgagagaactggaggtataatcataacaaacgataacttcagagaatttgttgttgaatcaccaagttggagggaaattattaaagaaagattgttgcagtacacttttgctggtgacatttttatgttacctgatgatccattaggaagatatgggcccaagctggatgatttcctcagcaaacagccaaacaaccgaactgtgcacagcagttttccatccagcaatgaaaggttcgttcctagggatcagtttgctcctccaagaaacatggcaccaaaaactggacttaatcagcccatggcaccaagagccggacataatcagcccatggcaccaagagccggacataatcagcccatggcaccaagaaccggacttagtcaacacagattcttgcaactgattaaaccacaagaaccttttacaccagctctgcacaatattgcccggccctgtcctataatgcctccagagagaagtccatctgagaccatgcaattaaaagaagcccttttgaaaatatttccagaggcagaccagagacataaaataaatgagatattaacagcccacccatttatgagggaccttaatgcactgtcagcaatggtacttgattaaaaacaagggacaccagcaattaaaatttattgaaggaaattatattttgcttttgaaatgtggtctcagggataaaactttaatacacacaatttgtaaagccaacttgtgacactagcagtttggataaatatatgctagaaatattgtgcaagtcagtattcttagcactgaaaatgtttgtgctgtacattatagcgattgtatttgaaattccctttcagacaggttttttttgtgcctcttaaaccctgattacctgatgctgtctttatatatttatatataacgaaacaagttataatttggtcatggaagacatcttgctatgtaggatgtttagttcatgcatttgtatagggacaggttaaaaaaaaaaaaaaaaaaaaaagtagtagttgggctcatttatcagcgctggacagatctgaaccagggcagtaactcatggcaacatatcatgtttgctttaattggtctacctgcagcattctacaaaaagttaattagtgattggttgctatgggttactgtccacgtgcaaatatgcacagtgttgggaaatgaccccagcgtatattttcatatgttttgtttaacctacaaaaatgtcactgtttattttgtggctgtttttaagcatcttgtgcagtttctgaatactgaagcagtccctgggacgttaaaatgtacaatccaatgcactttgagtaaaatgttttgtttctatttagcaggtaggttggctaaacctttaattctacgtgttcccttgtatctgtaaatagaaatatatacttatttaatttgcagtctgataatcccctagcagtatctaagcatagcacaggcataacactgtatgataattgatcccattttatcctaaccagttgtgaccacaagtattacagttaagctatttcatttaaaggacatataaaccccccaccaaaaaatgtaatcaatgaacatcctgtttttaaaaaggttaatagtaaggctcttggtttactgagcatgctcacttcttctcaactcaggttacgaaatgctctcaagtctagctaccaatgaagagatggcactgctgatttccatagaaatctaagctgtacactatgctggagaaacatgtttttttctccaaacctcctgccctgagctcagtttaaccattacagtgctcaatccaagcaggactttatcagttctgcctgtgttcttgattgcatgaactttacagggcacatgtgctgattgctgacatcactgaagatgtgtcagaggaaaaaatggctgttgagtaaaagctgctgtttgttttaggaaactttgatgatatgctgatgaaaggagagggtatatgcaatacgaatggtgtggtttaggtgggggaaatgtgcccaacttacatacatggtaggaaaatgtaggctttacatgttctttaataaaagaatgggcatttattatccctgtaaatttacaaggcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MASGSVQSSSGNGRRQAAVVDEFTVPGDKRSLLEKSRPRIQALFPVLFTVLGSLETFQQSEVKEDEEKPGRIWLQLKGEKQAVRRAKEYVKGICEPELEEKQSYPKEMHCIFAGAQSSFLNHLIQDTCADVALSDIGVLGIKGATEPVVMAQSRVQQFIALFKDNLSLPSHKEPAVKKKFKLYVEKHVDKYTVDLLLLPSALKSELLSLACDNQLSCEDLSRQSSDDKAECKVNQKDEVSRKGAGTPVTELTSQLDSVFSSAAEDSPCLIECPYSEQDRLSVKRRSSEAEERFSKKPFSLEAVQVDGPVNRNADKNNVPIIDLISEPSDFEDSVIVVEADDCVSSETEYKILVNFFKTMGYSQIVVEKVIDDLGQSEEPLKLLEEIEKQSKKELSVPFSQSSSYSTDLLKARGTSSLPKCKIAIAETVQSAAPSKVQPKALLATDKAGPSNPFCYKSQTKATVVNPIPTDQTTIVAPAERAFNNHFDPPLTGVQIFQNSLKVQYRLELKNEPGRWDLKHIIIDGSNVAMSHGLQRFFSCRGIALAVEYFWKKGHRNITVFVPQWRTKRDPFITEQHFLQQLQELGILSFTPSRTVLGARIASHDDRFLLHLAERTGGIIITNDNFREFVVESPSWREIIKERLLQYTFAGDIFMLPDDPLGRYGPKLDDFLSKQPNNRTVHSSFPSSNERFVPRDQFAPPRNMAPKTGLNQPMAPRAGHNQPMAPRAGHNQPMAPRTGLSQHRFLQLIKPQEPFTPALHNIARPCPIMPPERSPSETMQLKEALLKIFPEADQRHKINEILTAHPFMRDLNALSAMVLD
Donor tissue: tailbud