ORFeome > ngfr – XORFeome 2.0

ngfr – XORFeome 2.0

General Information

Species: Xenopus tropicalis ngfr protein, mRNA (cDNA clone MGC:79462 IMAGE:5382431), complete cds
Gene Symbol: ngfr
Gene ID: 493361
ORF gb_acc: MG133572
ORF ID: 11107

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080877

Library Location

Plate ID: GDExt11010
Well Location: A11

EST Sequences

Clone: MGC:79462 IMAGE:5382431
Trimmed Sequence: ATGAGGGGCCCTATTTTAACCATTTCCCTGCTGCTGATCTCCAAGATAGCGGCCGAAGATGTCTGCGAGAGTGGCCTCTTCACAAACAGTGGCAAATGCTGTTCCTTGTGCCCGCCGGGATTTGGGGTGACGGTGCCATGTGGAGTTTCAGATACCAAGTGTGAACCCTGCACAGAGAACTCTACTTTCTCTGACGTCAGAAGCGCCACGGCAAAGTGCCAGCCATGTTCCACCTGCCACGGTCCATCTACGACAATAGAATCGACCTGTACCCGCGAACAGGATACCGTATGTCGGTGTCCAGAAAGGCACTATCTGGACAGCTACGGCATTTGTTTCCCATGCCAGGTGTGCTCTAGGGGACATGGAGTTGTTGCACTCTGCACTCAAACTAAAAACACTGTGTGCCAGTTGTGCCCAAGTGGCTTCTACTCAGAGGTGAAGAGTAGTGAATCCCCTTGCCTGCCCTGCCGGACAGAATGCAAAGAGACCGAGGTGAAGATAGGAGATTGTGTGCCACTACATGACATTCTGTGCATGGATAAAGACGTTCCCCTCCTGAAACGCACTGAAGGGGATTCACGTGGCGAGAATGGCACCTCCCCTGGGTCCCACCACTTCATCCCACAGGAAGACAACAGTAAAAACATAATCCCTGTGTATTGCTCCATCTTGGCTGCTGTGGTGGTTGGGCTCATTGGTTACGTGGCGTTTAAGTGCTATACTACCTGCAAACAGAAGAAGCAATTGGCCAAAGCCAGAGCTGGAGAATTGGCTACATCCGGTGAGGGAGAAAAGTTGCACAGTGATAGCGGCGTCTTCCTTGACACACACAGTCTGCAGGAACAGAATCAGCTGAGCAAAGCCAAGACTGAACCCAAGCTCTACATTAATTTGCCACCTCACAAGCAGAGTGAAGTGGAGCGCCTGTTGGCGGACACCAGCCTTGGGAAAGATTGGCAGCGCCTCGCCAGCCTCTTGGGATACGAGGAGGAAACCATTGACACATTCGGGCGAGGAGTGGATCCAGTACATACTCTTCTCACTGACTGGTCTTCCAAAGAGAGCTCGACCCTGGAGGTCCTATGTGCTGCCTTGGTCAACATGGAACGGGCAGATGTGGTGGAAAATCTGAACAGCACAAACGATGGCAGCTCTGTGGTGTAA
Full Trace Sequence: gggcaggagagccgcacactggaacttgcacttggagccccccaataacctgggataggggagctgcctgggatcccctttattgccttctctctctctcccttggactgttcctaaaggaacccccccccccccttcctcggatctttagggctggaattagcttcaactgtaacccccgggcggcatacgtacaggagaaccggctgaggcgcagcggagaagagaccgcatccgtcctgctacctgggaggagagaggccagatccccagctatggatatgaggggccctattttaaccatttccctgctgctgatctccaagatagcggccgaagatgtctgcgagagtggcctcttcacaaacagtggcaaatgctgttccttgtgcccgccgggatttggggtgacggtgccatgtggagtttcagataccaagtgtgaaccctgcacagagaactctactttctctgacgtcagaagcgccacggcaaagtgccagccatgttccacctgccacggtccatctacgacaatagaatcgacctgtacccgcgaacaggataccgtatgtcggtgtccagaaaggcactatctggacagctacggcatttgtttcccatgccaggtgtgctctaggggacatggagttgttgcactctgcactcaaactaaaaacactgtgtgccagttgtgcccaagtggcttctactcagaggtgaagagtagtgaatccccttgcctgccctgccggacagaatgcaaagagaccgaggtgaagataggagattgtgtgccactacatgacattctgtgcatggataaagacgttcccctcctgaaacgcactgaaggggattcacgtggcgagaatggcacctcccctgggtcccaccacttcatcccacaggaagacaacagtaaaaacataatccctgtgtattgctccatcttggctgctgtggtggttgggctcattggttacgtggcgtttaagtgctatactacctgcaaacagaagaagcaattggccaaagccagagctggagaattggctacatccggtgagggagaaaagttgcacagtgatagcggcgtcttccttgacacacacagtctgcaggaacagaatcagctgagcaaagccaagactgaacccaagctctacattaatttgccacctcacaagcagagtgaagtggagcgcctgttggcggacaccagccttgggaaagattggcagcgcctcgccagcctcttgggatacgaggaggaaaccattgacacattcgggcgaggagtggatccagtacatactcttctcactgactggtcttccaaagagagctcgaccctggaggtcctatgtgctgccttggtcaacatggaacgggcagatgtggtggaaaatctgaacagcacaaacgatggcagctctgtggtgtaaccttggccctttcttcccagagcaaacccagttctatctttattaattgtataaacctcgtttcaagagaactttttttttatacaaagaaactgataaagtgtcaaggaaatgatttggttgatatgtcaacaagtgaccagtaatgactgtgactcacaaaagagagagatgctggcgtctcttagttgaacataggaattctgcaacaccagctcagtatggcttctatgggtcagtagaagcacttctcctcaggatggtcggtgcctttctcttgttggccaacaaaactaacggatacacgttctccaacgtacgacctgcaccctcaagccagaaattgtaaatattgtgtaagcctaattaaggtgttctaaaacacccaaagaaactgagaatttacaaggattttatcattttgaagaccttgctcacagaccttcttctctgtttgtaggacccaacttcagtaacatggtgctttaccagtcttccccctggcaaggtggcaaggggaagcaagtatgtagaaagtggaaaaaacaaaaacatttgtttatttttcttattctgcaacaaaagcagatgataaatcataaactgatttatatatatacatattttctttccaagattcatgtctgaccaaagataggtcaacttttctgttaataccaaatacgatcataggctcaactcttccttctgtcgagtcagctcctgatcgctgcattacaaaaaggccttggcattgtatcaaagtgttttagggagactcgtcttccctgtcattatttatatcagagcaatatgggactcgccaatctatacctgaatcataggtaaacatgaatggatgttcttctgtatcttcttcaatgttctttggcccccaggaccccctatgtcggtgtcttattccttcatatttcttttatccaatacacaagagaatgatttccactaatattttccctcatctgaaatgtttttttcttgcctttctacgtgtttttttcccagttcattcgagctgtgcctttggagagattatttaagagtttgcctgatgaagttggaaacaacaacaaacacaatctgaattgatttgtatggatattttaatataacagaatttattcccgccccccctaaaagccaaaccaagggagatcgtgctcaaggacttcttttttattgtgtgccttctaaacagttatgaaatgtaaactccctaaaacactaaaaaaaaaatttttttgtaagttgaaaaagatcgtaattattattttttaatttcctaaataaagctcactgctgcttgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MRGPILTISLLLISKIAAEDVCESGLFTNSGKCCSLCPPGFGVTVPCGVSDTKCEPCTENSTFSDVRSATAKCQPCSTCHGPSTTIESTCTREQDTVCRCPERHYLDSYGICFPCQVCSRGHGVVALCTQTKNTVCQLCPSGFYSEVKSSESPCLPCRTECKETEVKIGDCVPLHDILCMDKDVPLLKRTEGDSRGENGTSPGSHHFIPQEDNSKNIIPVYCSILAAVVVGLIGYVAFKCYTTCKQKKQLAKARAGELATSGEGEKLHSDSGVFLDTHSLQEQNQLSKAKTEPKLYINLPPHKQSEVERLLADTSLGKDWQRLASLLGYEEETIDTFGRGVDPVHTLLTDWSSKESSTLEVLCAALVNMERADVVENLNSTNDGSSVV
Donor tissue: neurula