ORFeome > nkx2-8 – XORFeome 2.0

nkx2-8 – XORFeome 2.0

General Information

Species: Xenopus tropicalis NK2 homeobox 8, mRNA (cDNA clone MGC:75807 IMAGE:5382280), complete cds
Gene Symbol: nkx2-8
Gene ID: 394548
ORF gb_acc: MG132918
ORF ID: 10284

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061321

Library Location

Plate ID: GDExt11004
Well Location: E04

EST Sequences

Clone: MGC:75807 IMAGE:5382280
Trimmed Sequence: ATGTCTTCTGGAGGGTTAAGCTTCACTGTCCGGAGGATTTTGGGTCTTCCAGAATTTGACAGCACAGCCATACAGAACGATTCACCCTTAAATTACACCAGTAGGACCCCATATCAAGACTGGTTGGATAATGAGCGAAACCACTTTCTCTCCTCGGATGACAGTGGGTCGGAGACCAACTCCCCAGACACTACACAGAGATCAGAAGTGGGATCTGACAGTGCAGAGACAGAGGAGAAGAAGAAGAAAAAGCGGAGAGTCCTTTTCTCAAAAGCTCAGACTTTGGAACTGGAGAGAAGGTTTCGCCAGCAGCGCTACCTATCGGCTCCAGAAAGGGACCAGTTGGCTCACATTCTGCACCTCACTCCCACTCAGGTCAAAATCTGGTTCCAAAACCACCGCTACAAGATGAAAAGGGTCAAGCCCGAAGCCAGCAGCACACCCCCTCTTCTCAAAAGGGTCATGGTTCCAGTTCTGGTGAGGGATGGCAAGCCATGTCAGACCTGCCCTTCTTCCCCACATTCAGAAAGGGAAAGTATCCAAGTGCTTCCCACTTTGCACTACAACTTTTTCCAAGGTTATCCTCATCATCAACAGGTAGCCCACCCTTCAAGTTTCTCCTGGAGATGGTGA
Full Trace Sequence: cttcactgtggaaaggagcagctctctgagagccagctttataggccactagcttcagcactgacaagggcttacagttccaccaacttcttgcctctgcttggggaacgacctgcagcacagagatgtcttctggagggttaagcttcactgtccggaggattttgggtcttccagaatttgacagcacagccatacagaacgattcacccttaaattacaccagtaggaccccatatcaagactggttggataatgagcgaaaccactttctctcctcggatgacagtgggtcggagaccaactccccagacactacacagagatcagaagtgggatctgacagtgcagagacagaggagaagaagaagaaaaagcggagagtccttttctcaaaagctcagactttggaactggagagaaggtttcgccagcagcgctacctatcggctccagaaagggaccagttggctcacattctgcacctcactcccactcaggtcaaaatctggttccaaaaccaccgctacaagatgaaaagggtcaagcccgaagccagcagcacaccccctcttctcaaaagggtcatggttccagttctggtgagggatggcaagccatgtcagacctgcccttcttccccacattcagaaagggaaagtatccaagtgcttcccactttgcactacaactttttccaaggttatcctcatcatcaacaggtagcccacccttcaagtttctcctggagatggtgactggactgctaactcctatcttgagtttacaaaggaatggacaccttgaggaagggaattgccgaaacgtagctgacttttgacagcaatagaaacccaaaacagccatagccagacctctgtgggctatacaaatgtagcactccagtactttgtttcttaaactggtaatataacaaagcaacagctctggatatttccctcagaagagtgaatggtatcccagactgatggtgcataattatatgtgtatttgtgtacatgtacagtatatatatatatatatatctatgggattttattttatgatattttctcatttgtgttatggatgtactgaatccactattttggaatttggctgaaccctgaatcctttatgaaagatttggccgaataccaaaccgaatccgagttcgtatacgcaaataagatcagtgttaaggagaaccctttgcacgcagtaaaaaaaattcatcatcagtgtttatgtgacaaaacatagattaggccaaatctggattctgctggaaaaggacgaatattagccaaatcctaaactgaatcctggattcggtgcatccctaatttgtatataattttttttttttttaaattgtaaaatatttcaatttaggcttcattagctatgtacagaaagaatgttttgctgatggatttaataaatggatttaaaataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSSGGLSFTVRRILGLPEFDSTAIQNDSPLNYTSRTPYQDWLDNERNHFLSSDDSGSETNSPDTTQRSEVGSDSAETEEKKKKKRRVLFSKAQTLELERRFRQQRYLSAPERDQLAHILHLTPTQVKIWFQNHRYKMKRVKPEASSTPPLLKRVMVPVLVRDGKPCQTCPSSPHSERESIQVLPTLHYNFFQGYPHHQQVAHPSSFSWRW
Donor tissue: neurula