ORFeome > nsmce1 – XORFeome 2.0

nsmce1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis non-SMC element 1 homolog (S. cerevisiae), mRNA (cDNA clone MGC:75888 IMAGE:5383246), complete cds
Gene Symbol: nsmce1
Gene ID: 394610
ORF gb_acc: MG133024
ORF ID: 10414

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061348

Library Location

Plate ID: GDExt11004
Well Location: D12

EST Sequences

Clone: MGC:75888 IMAGE:5383246
Trimmed Sequence: ATGGCTGAACAGATAAATGAGAGCCACCAGCGGTTCCTTCAGGTGCTCATGTCCCATGGCATTATGGAAAGCTCACTTGTAAGGGCACTGCACAGACATTGTTGCGAGGTCCATAAAGTTAACTACATGCATGACAATTTAGATGACTTTGTTGGTGTCTTAAATAAACATCTTCAGCCTCTGTTTATGAAGATAGAAAAAGGAGTAGGTGAAGAGGATGGACTTACATACTACGCATTGGTGAACCGTGTAGAAAATGATATTACAAAAATGGCTTCAGATTATGCTGAAAATGAGTTGGAGCTGTTCAGAAAAACAATGGAGTTAATTATTATATCTGAAAATGGATTTGCACCTCCCATAAGTATTCTCAACCTTGCTGATGAGCTGCAAAGCAAGAAGATGAAGAAGAAAGAAGTTGAACAACTGCTGCAGAGTTTTGTGCAGGACAAGTGGCTGATTGGGAGAAATGGAGAATATACCCTTCACACTCGCTGCATTATGGAGTTGGAACACTACATACTGAACACATACCAAGACGTTGCCAAAATTTGCAATGTCTGTCACAAAATAGCTATTCAGTGCCAGTTATGTGAGAATTGTGGAATCCCATTGCATTTGCAGTGTGCTGGAATATACTTCCGTGGAATAGCCAACCCGCTCTGCCCAAATTGCAAAGAGTCATGGCCTCATGAGATTCCAGATTTAAGCCAAGTCAGCTCACAAGGACCGTCCCATTCCCAGGCAGCGCCAGTCAGAGGTCGGAACCAGAGAAGCAGGAACATTTCCACAGTCGCAAGAACAAGTCGATAG
Full Trace Sequence: gtgaggcgctgaagtctttcgatacttttgattgggtttcagagactgcgggttttgaagtgatagtcggtacgcgggatagggagatatttctgggaagaatggctgaacagataaatgagagccaccagcggttccttcaggtgctcatgtcccatggcattatggaaagctcacttgtaagggcactgcacagacattgttgcgaggtccataaagttaactacatgcatgacaatttagatgactttgttggtgtcttaaataaacatcttcagcctctgtttatgaagatagaaaaaggagtaggtgaagaggatggacttacatactacgcattggtgaaccgtgtagaaaatgatattacaaaaatggcttcagattatgctgaaaatgagttggagctgttcagaaaaacaatggagttaattattatatctgaaaatggatttgcacctcccataagtattctcaaccttgctgatgagctgcaaagcaagaagatgaagaagaaagaagttgaacaactgctgcagagttttgtgcaggacaagtggctgattgggagaaatggagaatatacccttcacactcgctgcattatggagttggaacactacatactgaacacataccaagacgttgccaaaatttgcaatgtctgtcacaaaatagctattcagtgccagttatgtgagaattgtggaatcccattgcatttgcagtgtgctggaatatacttccgtggaatagccaacccgctctgcccaaattgcaaagagtcatggcctcatgagattccagatttaagccaagtcagctcacaaggaccgtcccattcccaggcagcgccagtcagaggtcggaaccagagaagcaggaacatttccacagtcgcaagaacaagtcgataggaacttcatagtcaatcgcactgtatttgtatgttttgtaataaaagtttgaccagacaagaaaatattctctacaaagagcactagagcgggaaaaccaaagcaaaatgtgaaaccacattttattccagtgtatactgtatatatgtatatatggttttgttatttgtcatgttgctggccctctgctgtgcatttagttgccacatgaaagggtcatttatgttgcatatgtgacaaagtaaaagaaacagattaaactgtactatgtgtatacctgtttatcacatggtcaaagttttgacaatggtgcagaaaactctcttctctgactttaatcaacttattcatggatctggctatggcaaacactgacagggaatgccaatgtaagttttcctgagcaatccctgcctgagttagccatgaacatgaatggaaagtggattctacttggatcaactgtaagttttcattgctataagtatattcagttctttattaaatgctttgttcagagttgaattaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAEQINESHQRFLQVLMSHGIMESSLVRALHRHCCEVHKVNYMHDNLDDFVGVLNKHLQPLFMKIEKGVGEEDGLTYYALVNRVENDITKMASDYAENELELFRKTMELIIISENGFAPPISILNLADELQSKKMKKKEVEQLLQSFVQDKWLIGRNGEYTLHTRCIMELEHYILNTYQDVAKICNVCHKIAIQCQLCENCGIPLHLQCAGIYFRGIANPLCPNCKESWPHEIPDLSQVSSQGPSHSQAAPVRGRNQRSRNISTVARTSR
Donor tissue: neurula