ORFeome > nsun4 – XORFeome 2.0

nsun4 – XORFeome 2.0

General Information

Species: Xenopus tropicalis NOL1/NOP2/Sun domain family, member 4, mRNA (cDNA clone MGC:79833 IMAGE:6987248), complete cds
Gene Symbol: nsun4
Gene ID: 493310
ORF gb_acc: MG133751
ORF ID: 11320

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080376

Library Location

Plate ID: GDExt11013
Well Location: A06

EST Sequences

Clone: MGC:79833 IMAGE:6987248
Trimmed Sequence: ATGGCAGCCTGCAGGGGATTTTTATTGAGGAGGATCAATGACTCGTGTCTGACCTTTCGTAGACATAAATTCAAGAAAAAATGGGCAACAACCCTTCCAAAAATTCCATGTTCAAGGCTTGCTTTGCAATATTTCGACATGAATTACAGCATGCAGTTTGGAGATCTATGGCCTTCAATTCGTATTAGTCTTCTCACAGAACAAAAGTATGGGGCTCTTGTCAATAATTTCTCACATAAGGAGACCGTATTGAAAAATCTCAGTGCTTTTAATGCAAAAGACTTTATCTCTGAGGCTCAACATGTGATATCATTATTGCAAATACAAAACAATTTGGACACCTCAGAAAAAATGACATCAGGTGAAGCATCTCTGAATCTGGTTGGACAGAAAAATAATGCAGAGAAAACTCAAGCAACAAACCTGCTTTCATCTCTTTCTAATACAAAACTCACATGTTTCAAATTTTCCAGGGGTGATATAAGTCGTTTTCCTCAATCAAGGTCAGACAGCTTTGGACTCCTGGAGTATTACTTAATGGATGCCGCCTCACTATTGCCTGTTTTGGCTCTTGATGTACAGCATGGTCATAGTGTTCTTGATCTTTGTGCAGCGCCTGGAGGAAAGACTTTGGCGCTTTTACAAACTGAAAATTGCCAATATCTTGCTGCCAATGACTTGTCTACTTCCCGAAGTAGCCGTCTCCACAGAGTTTTGCGTAGTTATGTTCCTAGAGCCCAGCGTACAGAGCATAAAGTGTGCATCACGTCGCAGGATGGAAGGCTGTGGGGAGATGCGGAGGCTAACACATATGACAGGGTCTTAGTGGATGTCCCTTGTACCACTGACCGCCATTCCCTTTTAGAAGAAGAAAACAACATCTTCCATCGTATAAGGACTAAGCAGCGCCAGATGTTGCCATTGTTACAAGCAGAACTGCTTGTGGCTGGGCTACGTGCTGTGAGGCCGGGTGGAGAAGTGGTGTACTCCACCTGTTCTTTGTCACAGTTGCAGAATGAATGTGTTGTGGAGAGGGCAGTTGAGCTTGCAGCTTCTGATCATGGAGTCCATGTTAAACCCCAGGACCTTAGCTGCTTCAGGGAAGTTTTCAAGAACACTTTTAACTTTTTTCAAGGGTGCCGTGTAGGAGAATTAGTCCTTCCTCATCTCACAGCAAATTTTGGACCCATGTTCTTCTGTAAACTTTTAAGAATTGAATAA
Full Trace Sequence: cttttttggtgcacagcaacatggcagcctgcaggggatttttattgaggaggatcaatgactcgtgtctgacctttcgtagacataaattcaagaaaaaatgggcaacaacccttccaaaaattccatgttcaaggcttgctttgcaatatttcgacatgaattacagcatgcagtttggagatctatggccttcaattcgtattagtcttctcacagaacaaaagtatggggctcttgtcaataatttctcacataaggagaccgtattgaaaaatctcagtgcttttaatgcaaaagactttatctctgaggctcaacatgtgatatcattattgcaaatacaaaacaatttggacacctcagaaaaaatgacatcaggtgaagcatctctgaatctggttggacagaaaaataatgcagagaaaactcaagcaacaaacctgctttcatctctttctaatacaaaactcacatgtttcaaattttccaggggtgatataagtcgttttcctcaatcaaggtcagacagctttggactcctggagtattacttaatggatgccgcctcactattgcctgttttggctcttgatgtacagcatggtcatagtgttcttgatctttgtgcagcgcctggaggaaagactttggcgcttttacaaactgaaaattgccaatatcttgctgccaatgacttgtctacttcccgaagtagccgtctccacagagttttgcgtagttatgttcctagagcccagcgtacagagcataaagtgtgcatcacgtcgcaggatggaaggctgtggggagatgcggaggctaacacatatgacagggtcttagtggatgtcccttgtaccactgaccgccattcccttttagaagaagaaaacaacatcttccatcgtataaggactaagcagcgccagatgttgccattgttacaagcagaactgcttgtggctgggctacgtgctgtgaggccgggtggagaagtggtgtactccacctgttctttgtcacagttgcagaatgaatgtgttgtggagagggcagttgagcttgcagcttctgatcatggagtccatgttaaaccccaggaccttagctgcttcagggaagttttcaagaacacttttaacttttttcaagggtgccgtgtaggagaattagtccttcctcatctcacagcaaattttggacccatgttcttctgtaaacttttaagaattgaataaaaactaaaaagattactgaattgaagatatgtttataccttaattcacctctgtaagtgttctcaactcaacgttgcaaatcatggaatacagatatagtggtatgaacagtggcgcataggatgttcttggaaatttgtttttttttttttttttaatatgtttacatattctggcagttatgaggacaactcaatttctattttaataaaaaaaaatgttagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAACRGFLLRRINDSCLTFRRHKFKKKWATTLPKIPCSRLALQYFDMNYSMQFGDLWPSIRISLLTEQKYGALVNNFSHKETVLKNLSAFNAKDFISEAQHVISLLQIQNNLDTSEKMTSGEASLNLVGQKNNAEKTQATNLLSSLSNTKLTCFKFSRGDISRFPQSRSDSFGLLEYYLMDAASLLPVLALDVQHGHSVLDLCAAPGGKTLALLQTENCQYLAANDLSTSRSSRLHRVLRSYVPRAQRTEHKVCITSQDGRLWGDAEANTYDRVLVDVPCTTDRHSLLEEENNIFHRIRTKQRQMLPLLQAELLVAGLRAVRPGGEVVYSTCSLSQLQNECVVERAVELAASDHGVHVKPQDLSCFREVFKNTFNFFQGCRVGELVLPHLTANFGPMFFCKLLRIE
Donor tissue: gastrula