ORFeome > odc1 – XORFeome 2.0

odc1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ornithine decarboxylase 1, mRNA (cDNA clone MGC:69433 IMAGE:5335701), complete cds
Gene Symbol: odc1
Gene ID: 448028
ORF gb_acc: MG133408
ORF ID: 10918

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074547

Library Location

Plate ID: GDExt11009
Well Location: D02

EST Sequences

Clone: MGC:69433 IMAGE:5335701
Trimmed Sequence: ATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAGCATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCCTGGGAGATACTATGTGGCCTCTGCTTTTACACTCGCAGTTAATATCATTGCCAAGAAAGTTATGGTGAATGAGCAAAGTGGATCTGATGATGAAGAGGATGCTGCCAATGACAAGACCCTGATGTACTATGTGAATGATGGCGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCAAAACCAGATGAGAGCTTCTACTCAAGCAGCATTTGGGGACCAACCTGTGATGGACTGGATCGTATTGTGGAAAGGTTCGACCTGCCAGAGCTACAAGTTGGAGACTGGATGTTATTTGAGAACATGGGCGCCTACACTGTTGCTGCATCCTCAACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTAATGTCAAGGCCACACTGGCAACTCATGCATGATATTAAAGAACATGGCATTCTCCCTGAAGTACCAGAACTGAGCGCACACCGTGTATCCTGTGCCCAGGAGAGTGGCATTGAGCTTGCCCCTACCATCTGTCCTACTGCCAGCATCAACGTATAG
Full Trace Sequence: ctcagctctgcgagtgctggttacggatagctgaagtgccgtttgtccgaggtggtcttttttttcctgcctggttatttgtggcctcgatgggtacagacttcgtaaatgctttttaagaatacaaacagcagaacagcgcagagcggctccatcgagagcgtaggacttgtcctctacttaccaggcttctatttcaccggcgagcctccttgggagtgaaactgaagctttctttatagttatcccccatctcttacttgtccattttgttgcatagtttgcctcttgaaacaaaataactgcaaaaatgaacagcttcagcaatgacgactttgacttcagtttcctggaggaaggtttctgtgccagggatattgtggagcaaaagatcaatgaagtgtccttatctgatgacaaagatgccttttatgttgctgatcttggtgacattgtgaaaaagcatgtacgttggtttaaagcactcccacgtgtcactccattttatgctgtaaaatgcaatgacagcaaagccatcgtgaagactctctccctccttggtgcaggctttgactgtgccagtaagacggaaatccaactagtacaaagtattggagtgtcatctgagcgaattatctatgcaaatccatgtaaacaagtctcccagatcaaatacgcagctagctgtggtgttgagaagatgacttttgacagtgaagtagaactaatgaaagtggcaaggaatcacccaaatgcaaagcttgttctgcgcatagcaactgatgactcaaaagctgtctgccgcctcagtgtaaaatttggtgccacccttaaaacaagcaggctgcttctggagcgggcaaaagagcttaatgtggaaataattggtgtaagtttccatgttggcagtggctgcactgatcctcagacttatgtacaagctgtctcagatgcacgatgtgtctttgacatgggggctgagcttggattcagcatgcatttacttgacattggtggaggattccctggttcagaggacgttaaactgaagtttgaagagattacatctgtgataaacccagccctggataagtacttcccagtagattctggagtgaccatcattgctgagcctgggagatactatgtggcctctgcttttacactcgcagttaatatcattgccaagaaagttatggtgaatgagcaaagtggatctgatgatgaagaggatgctgccaatgacaagaccctgatgtactatgtgaatgatggcgtgtatggatctttcaactgcatcttgtttgatcatgcacatgtcaagccagttctaacaaagaaaccaaaaccagatgagagcttctactcaagcagcatttggggaccaacctgtgatggactggatcgtattgtggaaaggttcgacctgccagagctacaagttggagactggatgttatttgagaacatgggcgcctacactgttgctgcatcctcaacattcaatggatttcagagaccaaccctttattatgtaatgtcaaggccacactggcaactcatgcatgatattaaagaacatggcattctccctgaagtaccagaactgagcgcacaccgtgtatcctgtgcccaggagagtggcattgagcttgcccctaccatctgtcctactgccagcatcaacgtataggcttattaacaaacgctgtagttcaactgcaactgtagtcttgggaccatttatttaaatttaactcattctttttttctagattgtatttgccagcattaatgcaacaaaatggatgactgtgagatggggtcacattatctgtgttcctatggaaactttttttttatgttttttgaagtatattggagatgcaaattatcactcaagcatttgtagcttgtgtattgccagtcagcatcttcattgaccagttttacaaataaagtgttcaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MNSFSNDDFDFSFLEEGFCARDIVEQKINEVSLSDDKDAFYVADLGDIVKKHVRWFKALPRVTPFYAVKCNDSKAIVKTLSLLGAGFDCASKTEIQLVQSIGVSSERIIYANPCKQVSQIKYAASCGVEKMTFDSEVELMKVARNHPNAKLVLRIATDDSKAVCRLSVKFGATLKTSRLLLERAKELNVEIIGVSFHVGSGCTDPQTYVQAVSDARCVFDMGAELGFSMHLLDIGGGFPGSEDVKLKFEEITSVINPALDKYFPVDSGVTIIAEPGRYYVASAFTLAVNIIAKKVMVNEQSGSDDEEDAANDKTLMYYVNDGVYGSFNCILFDHAHVKPVLTKKPKPDESFYSSSIWGPTCDGLDRIVERFDLPELQVGDWMLFENMGAYTVAASSTFNGFQRPTLYYVMSRPHWQLMHDIKEHGILPEVPELSAHRVSCAQESGIELAPTICPTASINV
Donor tissue: tailbud