ORFeome > osp94 – XORFeome 2.0

osp94 – XORFeome 2.0

General Information

Species: Xenopus tropicalis osmotic stress protein 94 kDa, mRNA (cDNA clone MGC:76295 IMAGE:5379533), complete cds
Gene Symbol: osp94
Gene ID: 394863
ORF gb_acc:
ORF ID: 10235

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063930

Library Location

Plate ID: GDExt11003
Well Location: E04

EST Sequences

Clone: MGC:76295 IMAGE:5379533
Trimmed Sequence: ATGTCGGTGGTGGGCTTTGACTTGGGATTCCTGAGCTGCTATGTCGCCGTCGCTCGGGCCGGGGGTATCGAAACGGTGGCCAATGAATACAGCGACCGCAGCACCCCAGCATGTATTTCATTTGGTCCGAAGAATCGATCTATTGGAGCAGCAGCCAAAAGTCAAGTAATATCAAACGCAAAGAACACATTACAAGGCTTCAAAAGGTTCCATGGGCGGGCATACACAGATCCATTTGTGCAAGCAGAAAAGCCTGGTCTTGCCTTTGAACTCGTAGAGTTGCCGACAGGCTCTGCAGGAATCAAGGTTGTATACTTGGAAGAGGAGAGATCTTTTACCATTGAACAGGTGACTGCAATGCAGCTAACCAAGCTGAAAGAAACTGCAGAGAGTGCACTGAAAAAACCTGTAGTGGACTGTGTTGTGGCTGTTCCCTCTTTCTTTACGGATGCAGAACGGCGGTCTGTAGTTGATGCCACACAGATTGCAGGGCTGAACTGTTTGCGCCTTATTAATGAAACAACTGCAGTTGCTTTGGCCTATGGTATTTATAAGCAAGACTTGCCTGCTCCAGAAGAGAAACCCAGAATTGTGGTCTTTGCGGATATGGGACATTCCGCCTATCAAGTGTCTGTCTGTGCATTTAACAAGGGCAAACTCAAGGTCCTTGCCACATCATTTGACCCTACATTGGGTGGCAGGAAGTTTGATGACGTTTTGGTAAACTATTTCGTTGAAGAATTTGGCAAAAAATACAAGCTGGATATCAAGTCCAAGATTAGGCCTTTGCTACGTCTTGCTCAGGAGTGTGAGAAGCTTAAGAAATTGATGAGTGCAAATGCTTCGGAACTGCCACTTAATATTGAATGTTTCATGAATGACATTGATGTGACTGGATCTATGAATCGAGGGCATTTTGAAGAAATGTGTGACAGCCTTTTATCTCGAGTTGAACCACCACTACGAAGTGTTTTGGAACAAGCCAAACTAAAAAAAGAAGATATTTATGCAGTAGAGATAGTTGGCGGTGCCACTCGAATCCCTGCTGTGAAGGAGAGAATAATGAGGTTCTTTGGTAAAGAAGTCAGTACAACACTGAATGCTGATGAAGCTGTAGCCCGAGGCTGTGCATTGCAGTGTGCAATCCTATCCCCAGCTTTTAAAGTGCGAGAATTTTCCATCACAGATCTAGTACCATATCCTATATCATTAAAATGGAATTCTCCAGCTGAGGAAGGCTTAAGTGATTGTGAAGTCTTCCCTAAGAATCATGCAGCTCCCTTTTCCAAAGTGCTTACTTTCTACAGGAAGGAGTCATTCAATCTTGATGCTTACTACAGTGCTCCCAAGGAATTGCCCTATCCAGACCCATCCTTAGGTCAATTTCATATTCAGAAAGTCATCCCACAAGCTGATGGGTCCAGTTCTAAAGTAAAGGTGAAAGTACGAGTCAATATCCATGGAATATTTAGTGTATCCAGTGCCTCTCTTGTTGAAATCCACAAAACAGAAGATGGTGAGGAACCCATGGAAACAGACCAGGTTACAAAGGAGGAGGAGAAAATGCAAGTTGATCAAGAAGAAGCTAAACCAGAAGAGAACCAGCAAGCAGAAAGCAAGACGAACCCTGATGAGATGGAGACCTCACAACCTGGGACCAAGGATAAAAAGACCGATCAGCCTCCCCAAGCCAAGAAAGCAAAAGTGAAGACCAGCACAGTTGACTTGCCCATTGAACACTACCCCCCATGGCAGATTGGCAGGGACATGCTTAATTTGTTTGTTGAGAATGAGGGCAAGATGATTATGCAAGACAAATTGGAAAAGGAACGGAACGATGCCAAGAATGCAGTAGAAGAATATGTGTATGAGATGAGGGACAAGCTTAGTGGAATCTATGAGAAGTTTGTCAGCGAAGATGACCGGAACAGCTTCATTCTAAAACTAGAGGACACTGAAAACTGGCTGTATGAAGATGGGGAAGATCAGCCCAAACAAGTTTATATTGATAAATTAAATGATTTGAAGAAATTAGGGAACCCTATACAGATACGCAATCAGGAATATGAGGAAAGACCAAAAGCTTTTGATGAACTGGGGAAGCAAATTCAACTCTACTTGAAAGTTGTTAATGCCTTCAAAAATAAGGAAGAGGCATACGATCACTTGGATCCTGCTGATATGGAAAAAATGGAAAAGAGTGTAAATGAGGCCATGGAATGGCTGAATAACAAAATGAATTTACAGATGAAGCAAGATCCTACTGCAGACCCAATAGTGAAGACCAAGGAAATCCAAGGCAAAACTAAAGAGTTAATAAACCTGTGCAACCCAATAGTAACAAAACCGAAGCCCAAGGTCGAGCCACCAAAAGAGGAGCAGTCAAATGAGCAGAATGGACCAGTTGATGGTAGTGCAAACAGCCAAGGGCCACAGGCTGCTGAGCCGAATCCAGATCCAGCTGCTACAGAGGCAGAGAAGAAGCTTCCTGAAATGGACATTGAATAA
Full Trace Sequence: ctcgcggctccattcatctcccccctgcggagaatagcacagtgcggctgcccgccggatctcagtgcttcccgctgcccctccgccgtccaccctgcttgtcgctgtgctgtagacatgtcggtggtgggctttgacttgggattcctgagctgctatgtcgccgtcgctcgggccgggggtatcgaaacggtggccaatgaatacagcgaccgcagcaccccagcatgtatttcatttggtccgaagaatcgatctattggagcagcagccaaaagtcaagtaatatcaaacgcaaagaacacattacaaggcttcaaaaggttccatgggcgggcatacacagatccatttgtgcaagcagaaaagcctggtcttgcctttgaactcgtagagttgccgacaggctctgcaggaatcaaggttgtatacttggaagaggagagatcttttaccattgaacaggtgactgcaatgcagctaaccaagctgaaagaaactgcagagagtgcactgaaaaaacctgtagtggactgtgttgtggctgttccctctttctttacggatgcagaacggcggtctgtagttgatgccacacagattgcagggctgaactgtttgcgccttattaatgaaacaactgcagttgctttggcctatggtatttataagcaagacttgcctgctccagaagagaaacccagaattgtggtctttgcggatatgggacattccgcctatcaagtgtctgtctgtgcatttaacaagggcaaactcaaggtccttgccacatcatttgaccctacattgggtggcaggaagtttgatgacgttttggtaaactatttcgttgaagaatttggcaaaaaatacaagctggatatcaagtccaagattaggcctttgctacgtcttgctcaggagtgtgagaagcttaagaaattgatgagtgcaaatgcttcggaactgccacttaatattgaatgtttcatgaatgacattgatgtgactggatctatgaatcgagggcattttgaagaaatgtgtgacagccttttatctcgagttgaaccaccactacgaagtgttttggaacaagccaaactaaaaaaagaagatatttatgcagtagagatagttggcggtgccactcgaatccctgctgtgaaggagagaataatgaggttctttggtaaagaagtcagtacaacactgaatgctgatgaagctgtagcccgaggctgtgcattgcagtgtgcaatcctatccccagcttttaaagtgcgagaattttccatcacagatctagtaccatatcctatatcattaaaatggaattctccagctgaggaaggcttaagtgattgtgaagtcttccctaagaatcatgcagctcccttttccaaagtgcttactttctacaggaaggagtcattcaatcttgatgcttactacagtgctcccaaggaattgccctatccagacccatccttaggtcaatttcatattcagaaagtcatcccacaagctgatgggtccagttctaaagtaaaggtgaaagtacgagtcaatatccatggaatatttagtgtatccagtgcctctcttgttgaaatccacaaaacagaagatggtgaggaacccatggaaacagaccaggttacaaaggaggaggagaaaatgcaagttgatcaagaagaagctaaaccagaagagaaccagcaagcagaaagcaagacgaaccctgatgagatggagacctcacaacctgggaccaaggataaaaagaccgatcagcctccccaagccaagaaagcaaaagtgaagaccagcacagttgacttgcccattgaacactaccccccatggcagattggcagggacatgcttaatttgtttgttgagaatgagggcaagatgattatgcaagacaaattggaaaaggaacggaacgatgccaagaatgcagtagaagaatatgtgtatgagatgagggacaagcttagtggaatctatgagaagtttgtcagcgaagatgaccggaacagcttcattctaaaactagaggacactgaaaactggctgtatgaagatggggaagatcagcccaaacaagtttatattgataaattaaatgatttgaagaaattagggaaccctatacagatacgcaatcaggaatatgaggaaagaccaaaagcttttgatgaactggggaagcaaattcaactctacttgaaagttgttaatgccttcaaaaataaggaagaggcatacgatcacttggatcctgctgatatggaaaaaatggaaaagagtgtaaatgaggccatggaatggctgaataacaaaatgaatttacagatgaagcaagatcctactgcagacccaatagtgaagaccaaggaaatccaaggcaaaactaaagagttaataaacctgtgcaacccaatagtaacaaaaccgaagcccaaggtcgagccaccaaaagaggagcagtcaaatgagcagaatggaccagttgatggtagtgcaaacagccaagggccacaggctgctgagccgaatccagatccagctgctacagaggcagagaagaagcttcctgaaatggacattgaataaattccatcttttatttctattctaaaacagtataataaagctttaagttgttacccacatacggctcagagtaccagtctgaggaaagagacagcagttttcctagttacctagccacccttttatttcccctccgcatttcttttttttattttttactgatcatttgacattcgtattgtttgtttgaatgttcttttctatttatgttgctttagcgtaaatccttgttgctacaactgattagtgttggctgtaacttgcacattagccagaaggccaatgtgtccgaagctacaaaaggtatgcagcttaatagcagaactcaaggcctacctacctacctacctacctacagaaagctgaaatgctacgaaaagctcttgccacaatcaaaggacactcctgtgttctgcgctttaaacttttactccagatcctaaagtcttggtttgcatctttccctgtatgttgcacttctgcctcactgacagctggttccctgcattaacaaaaccttttgcatggcagcctggtggtgcaacaagaaaccagagtattaaaacccagcactggcagctttccctttaggtagtaccctgagtttattgtactggcatttgcttgatcccgttatgttttccattactaaggtgtaggtgtgagttctatatacagtttgataggtaccgttcgccatcgctttatggaagtcacaacgaaaagcttcaatagtttaatggcctttgttgtttctgattagtgtttaattcagactaagccacgaatgaccatcttcaatgctggatttttaaaagaactacatgcatatagccctgttcctgggggaatggtgcagcaagtattgctttataactaaggcttaatataacagcatcacatgaaatggacaggggagtcgcttaagccaatgcaatgcagttagtttgtcaatcatatgtcatgtgattttaaacatggggcaagtatttgggaattgttttttgtctttataggattctggctgccatattggtgccatgagacaactggattatagaacatgaatgttggctaaaattcttgcctcaagaaggtttgttggaagcggaaacagtcacaggcataatttacacctaatattgatgctgatttagtaaccagttaccatacccccatagaaaatccatctttgtaatttttttttatgattgttacataaccaaaactctaaaacacagcagttcttgtctcaaaataaacattgctgggttgcaaaaaaaaaaaaaaaaaaaaa
Translation: MSVVGFDLGFLSCYVAVARAGGIETVANEYSDRSTPACISFGPKNRSIGAAAKSQVISNAKNTLQGFKRFHGRAYTDPFVQAEKPGLAFELVELPTGSAGIKVVYLEEERSFTIEQVTAMQLTKLKETAESALKKPVVDCVVAVPSFFTDAERRSVVDATQIAGLNCLRLINETTAVALAYGIYKQDLPAPEEKPRIVVFADMGHSAYQVSVCAFNKGKLKVLATSFDPTLGGRKFDDVLVNYFVEEFGKKYKLDIKSKIRPLLRLAQECEKLKKLMSANASELPLNIECFMNDIDVTGSMNRGHFEEMCDSLLSRVEPPLRSVLEQAKLKKEDIYAVEIVGGATRIPAVKERIMRFFGKEVSTTLNADEAVARGCALQCAILSPAFKVREFSITDLVPYPISLKWNSPAEEGLSDCEVFPKNHAAPFSKVLTFYRKESFNLDAYYSAPKELPYPDPSLGQFHIQKVIPQADGSSSKVKVKVRVNIHGIFSVSSASLVEIHKTEDGEEPMETDQVTKEEEKMQVDQEEAKPEENQQAESKTNPDEMETSQPGTKDKKTDQPPQAKKAKVKTSTVDLPIEHYPPWQIGRDMLNLFVENEGKMIMQDKLEKERNDAKNAVEEYVYEMRDKLSGIYEKFVSEDDRNSFILKLEDTENWLYEDGEDQPKQVYIDKLNDLKKLGNPIQIRNQEYEERPKAFDELGKQIQLYLKVVNAFKNKEEAYDHLDPADMEKMEKSVNEAMEWLNNKMNLQMKQDPTADPIVKTKEIQGKTKELINLCNPIVTKPKPKVEPPKEEQSNEQNGPVDGSANSQGPQAAEPNPDPAATEAEKKLPEMDIE
Donor tissue: tailbud