ORFeome > pigm – XORFeome 2.0

pigm – XORFeome 2.0

General Information

Species: Xenopus tropicalis pigm protein, mRNA (cDNA clone MGC:89442 IMAGE:6991044), complete cds
Gene Symbol: pigm
Gene ID: 493482
ORF gb_acc: MG133864
ORF ID: 11446

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC081324

Library Location

Plate ID: GDExt11014
Well Location: H11

EST Sequences

Clone: MGC:89442 IMAGE:6991044
Trimmed Sequence: ATGATGAAGCAAGCTGGCATATTAAAGATTTTTTTACAGCATCAGTTTATGTTTCCCACTGCGTTCTTCTTAAGAAGTGCTCTTGTGCTATTTGGAGTATACCAAGATCAGACTATGCTGGTGAAATATACTGATGTTGACTATCATGTTTTCACAGATGCAGCCGAATACCTCACTCAGGGGGTCTCACCATATAAGAGAGCGACATATCGTTACACTCCATTGTTGGCCTGGATCCTTACACCAAACATCTATGTCACAGAGCTCTATGGCAAGATGTTATTTGTTTGCTGTGACCTTTTAGCAGCATACCTGATCCACAGAATCCTTGTGGATAGGGGAATTAAAGACTCTGCTAGCCTATACTGTGCAATTTGGCTCTTTAACCCTCTGCCTATGGTTGTATCCAGTAGAGGAAATGCTGAATCAGTTTTAGCTGTGCTTGTGCTTTCTGTATTGTATTATGTGCAAAAGCGAAGGCTTATAAAAGGAGCTTTGATCTATGGACTCTCTGTTCATATGAAGATTTACCCAATAACATACATCCTCCCTATTGCTTTGTTCTTCCAAAAAGAAGATTTTTATGGGAGCCAAGAAGGAAAAAGAGTTGTCTCAAATTTAAAATATATCAGAATATTTAGGAATCTATTGCAGAGACTACTTTCTCGTGACATTCTACTATTTGTAACTGTGTCAGGTGTGACTTTTGCTTTGCTGACACTTTTTTTTTACTACAGATATGGTTGGGAATTTCTTGAAAACACCTACCTCTACCATCTGACTAGGAGGGATATACGGCACAATTTCTCTCCATATTTCTACATGCTTTATTTGACTGCTGAGAATAATAACAGCTTTATCTTGGGCCTTGCAGCATTTTTTCCTCAACTTGTCTTACTTTTTGTGGTGTCTCTAGCCTACTTCAAAGACCTCCCTTTCTGCTGCTTCCTCCACACTGCAATTTTTGTAAGCTTCAACAAAGTATGCACCTCTCAGTATTTTCTCTGGTATCTCTGTCTGCTACCTCTGGTGATGCCTGGGCTGAAGATGTCCATGACCAATGGGATATGCCTTATAATATTGTGGTTCTTCAGCCAGGCAATATGGTTGGTTCCTGCTTACTTTCTGGAATTTGAAGGCCAAAATACATTTTTATACATCTGGTGTGCTGGATTGTTATTTTTGCTTATTAACACTGTCATTATTGTTCAGATCATCTCAAATTATCAGTTACAGAGTAAAAAGACCAAGAAAACATAG
Full Trace Sequence: cgtccacttcccacctttcacgttctgcttcttttcttgtagcacccacaccgaacccgtgctcctggtctgtcaccccggaaagcgtcacgccctttgcctcctgcagtgtacggcatcgcttattttcagaagacttgtggaccaatgaaactgaatacagtttgtgaatcaaatttaatggcagtttagtcaaaaaggctggtcaatatgctgctcaaatgaatttacaactttccatgtttctacctaagaatataccagaacgatctgttatctgctaaagtaagatgatgaagcaagctggcatattaaagatttttttacagcatcagtttatgtttcccactgcgttcttcttaagaagtgctcttgtgctatttggagtataccaagatcagactatgctggtgaaatatactgatgttgactatcatgttttcacagatgcagccgaatacctcactcagggggtctcaccatataagagagcgacatatcgttacactccattgttggcctggatccttacaccaaacatctatgtcacagagctctatggcaagatgttatttgtttgctgtgaccttttagcagcatacctgatccacagaatccttgtggataggggaattaaagactctgctagcctatactgtgcaatttggctctttaaccctctgcctatggttgtatccagtagaggaaatgctgaatcagttttagctgtgcttgtgctttctgtattgtattatgtgcaaaagcgaaggcttataaaaggagctttgatctatggactctctgttcatatgaagatttacccaataacatacatcctccctattgctttgttcttccaaaaagaagatttttatgggagccaagaaggaaaaagagttgtctcaaatttaaaatatatcagaatatttaggaatctattgcagagactactttctcgtgacattctactatttgtaactgtgtcaggtgtgacttttgctttgctgacactttttttttactacagatatggttgggaatttcttgaaaacacctacctctaccatctgactaggagggatatacggcacaatttctctccatatttctacatgctttatttgactgctgagaataataacagctttatcttgggccttgcagcattttttcctcaacttgtcttactttttgtggtgtctctagcctacttcaaagacctccctttctgctgcttcctccacactgcaatttttgtaagcttcaacaaagtatgcacctctcagtattttctctggtatctctgtctgctacctctggtgatgcctgggctgaagatgtccatgaccaatgggatatgccttataatattgtggttcttcagccaggcaatatggttggttcctgcttactttctggaatttgaaggccaaaatacatttttatacatctggtgtgctggattgttatttttgcttattaacactgtcattattgttcagatcatctcaaattatcagttacagagtaaaaagaccaagaaaacatagatggaactagtctctgatattgatccttttgcaatgtatatttgactgagaatagagtccagatggctcagaaaacagcaagtatttctacagtagaatgcacaagtcctttttaaaaaagggcaaattaattctttaacattttcttgggaaattctgctgtgactctataaaataaaacacagtgcaatgaaaaaaaaagaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MMKQAGILKIFLQHQFMFPTAFFLRSALVLFGVYQDQTMLVKYTDVDYHVFTDAAEYLTQGVSPYKRATYRYTPLLAWILTPNIYVTELYGKMLFVCCDLLAAYLIHRILVDRGIKDSASLYCAIWLFNPLPMVVSSRGNAESVLAVLVLSVLYYVQKRRLIKGALIYGLSVHMKIYPITYILPIALFFQKEDFYGSQEGKRVVSNLKYIRIFRNLLQRLLSRDILLFVTVSGVTFALLTLFFYYRYGWEFLENTYLYHLTRRDIRHNFSPYFYMLYLTAENNNSFILGLAAFFPQLVLLFVVSLAYFKDLPFCCFLHTAIFVSFNKVCTSQYFLWYLCLLPLVMPGLKMSMTNGICLIILWFFSQAIWLVPAYFLEFEGQNTFLYIWCAGLLFLLINTVIIVQIISNYQLQSKKTKKT
Donor tissue: gastrula