ORFeome > pisd – XORFeome 2.0

pisd – XORFeome 2.0

General Information

Species: Xenopus tropicalis phosphatidylserine decarboxylase, mRNA (cDNA clone MGC:69534 IMAGE:5336619), complete cds
Gene Symbol: pisd
Gene ID: 448069
ORF gb_acc: MG133346
ORF ID: 10848

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074595

Library Location

Plate ID: GDExt11009
Well Location: F03

EST Sequences

Clone: MGC:69534 IMAGE:5336619
Trimmed Sequence: ATGCGTGGAGCAAAGCAGTCTGGGGGCATCGTGCAACGTTCCAAGAGATGGTTACCTGTGCCTCGACTTTCCATCAAGCGGCGCCTCGGTCAGCTTCCGCCTTCATTAAGACTGCGCTCTTGGCAGCTGCTTAAGCCACTCCTACATGCTGGGCTTCGCCCACCTAGTCGTGTTAGCAAGGCTGTGTACAGCAGAGCCCCCACGCGCCTGTTATCTCGAGTGTGGGGCCTGATTAATGAGGTCAACCTCCCTCACTGGTTGCGCCGGCCCCTGCTCTCACTCTACGTATGGGCCTTCTCTGTGAATATGGCCGAGGCCGAGGAGGAAGATTTAAACCGGTATCAGAACTTGGGGGAGCTCTTCCGACGGTCACTGAAACCCACAGCCAGAACCATTGACTCTCATTGTGTGGTCAGTCCATGTGACGGACGTGTTCTGCACAGTGGCCGAGGCCGTGGTTCTCAGATCGAGCAAGTTAAAGGTCTGACATATTCACTGGAGAGCTTCTTGGGACCCCAAGACTGGCGGGAACCAACAAATCTATGCCTGCCACTCCTGCAGCAGTTAGGTGTAAGATCCTCCAGCCGGATCTACCACCATGTCATATACTTGGCACCGGGTGATTATCATCGCTTCCATTCCCCGACAGACTGGAATGTCCAGCATCGGAGGCACTTTCCAGGAGCACTCATGTCCGTCAGTCCTCACGTTGCCCACTGGATACCCAGTCTCTTCTGCCAGAATGAACGTGTTGTGCTTAGCGGCCAGTGGCAGTTTGGCTTCTTCTCGCTAACAGCAGTGGGAGCAACTAATGTTGGATCCATCCGTATCTATGGGGACCAGGACCTGCACACCAACTGCTCCCGCCACGTCAAAGGAAAGTACCATGACTACAGCTATACGGATCAGTATGGACCTGAAGGACTATCCCTAGTGAAGGGACAACCCTTGGGCGAGTTCAACTTTGGTTCCACCATTGTGCTTATCTTTGAAGGACCTCTTCAATTCAAGTTCCAGATCACGGCAGGGGGACGGATTCATGTTGGAGAGGCCCTGGGAACCTTTTGA
Full Trace Sequence: gtacatgccagctcctatgagaggcgtgagtgccaggggtgagagtgtgtcctatctggtttggccatgcgtggagcaaagcagtctgggggcatcgtgcaacgttccaagagatggttacctgtgcctcgactttccatcaagcggcgcctcggtcagcttccgccttcattaagactgcgctcttggcagctgcttaagccactcctacatgctgggcttcgcccacctagtcgtgttagcaaggctgtgtacagcagagcccccacgcgcctgttatctcgagtgtggggcctgattaatgaggtcaacctccctcactggttgcgccggcccctgctctcactctacgtatgggccttctctgtgaatatggccgaggccgaggaggaagatttaaaccggtatcagaacttgggggagctcttccgacggtcactgaaacccacagccagaaccattgactctcattgtgtggtcagtccatgtgacggacgtgttctgcacagtggccgaggccgtggttctcagatcgagcaagttaaaggtctgacatattcactggagagcttcttgggaccccaagactggcgggaaccaacaaatctatgcctgccactcctgcagcagttaggtgtaagatcctccagccggatctaccaccatgtcatatacttggcaccgggtgattatcatcgcttccattccccgacagactggaatgtccagcatcggaggcactttccaggagcactcatgtccgtcagtcctcacgttgcccactggatacccagtctcttctgccagaatgaacgtgttgtgcttagcggccagtggcagtttggcttcttctcgctaacagcagtgggagcaactaatgttggatccatccgtatctatggggaccaggacctgcacaccaactgctcccgccacgtcaaaggaaagtaccatgactacagctatacggatcagtatggacctgaaggactatccctagtgaagggacaacccttgggcgagttcaactttggttccaccattgtgcttatctttgaaggacctcttcaattcaagttccagatcacggcagggggacggattcatgttggagaggccctgggaaccttttgatgactttgcactaaggagcaacagtattgacacctaaacggactctagggtgttgaacacccttagtttatttttttgttgttttttttaaaaaaaaatcatttttctaataatggaaaacaaagcacatgaaactgttaggaaatcgtgattttatttaaaatacaatttataaaaacgacaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MRGAKQSGGIVQRSKRWLPVPRLSIKRRLGQLPPSLRLRSWQLLKPLLHAGLRPPSRVSKAVYSRAPTRLLSRVWGLINEVNLPHWLRRPLLSLYVWAFSVNMAEAEEEDLNRYQNLGELFRRSLKPTARTIDSHCVVSPCDGRVLHSGRGRGSQIEQVKGLTYSLESFLGPQDWREPTNLCLPLLQQLGVRSSSRIYHHVIYLAPGDYHRFHSPTDWNVQHRRHFPGALMSVSPHVAHWIPSLFCQNERVVLSGQWQFGFFSLTAVGATNVGSIRIYGDQDLHTNCSRHVKGKYHDYSYTDQYGPEGLSLVKGQPLGEFNFGSTIVLIFEGPLQFKFQITAGGRIHVGEALGTF
Donor tissue: tailbud